ID: 1199782805

View in Genome Browser
Species Human (GRCh38)
Location X:151078537-151078559
Sequence AAAATGGGAAACATTCTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199782805_1199782810 22 Left 1199782805 X:151078537-151078559 CCTAGGAGAATGTTTCCCATTTT No data
Right 1199782810 X:151078582-151078604 AGAAAAGCAGCAATCTAACCAGG No data
1199782805_1199782811 23 Left 1199782805 X:151078537-151078559 CCTAGGAGAATGTTTCCCATTTT No data
Right 1199782811 X:151078583-151078605 GAAAAGCAGCAATCTAACCAGGG No data
1199782805_1199782808 -4 Left 1199782805 X:151078537-151078559 CCTAGGAGAATGTTTCCCATTTT No data
Right 1199782808 X:151078556-151078578 TTTTACTTCTGAGTAAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199782805 Original CRISPR AAAATGGGAAACATTCTCCT AGG (reversed) Intergenic
No off target data available for this crispr