ID: 1199782806

View in Genome Browser
Species Human (GRCh38)
Location X:151078552-151078574
Sequence TGTTTACTCAGAAGTAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199782806_1199782810 7 Left 1199782806 X:151078552-151078574 CCCATTTTACTTCTGAGTAAACA No data
Right 1199782810 X:151078582-151078604 AGAAAAGCAGCAATCTAACCAGG No data
1199782806_1199782812 17 Left 1199782806 X:151078552-151078574 CCCATTTTACTTCTGAGTAAACA No data
Right 1199782812 X:151078592-151078614 CAATCTAACCAGGGTCCCATAGG No data
1199782806_1199782814 28 Left 1199782806 X:151078552-151078574 CCCATTTTACTTCTGAGTAAACA No data
Right 1199782814 X:151078603-151078625 GGGTCCCATAGGATAGTAGTAGG No data
1199782806_1199782811 8 Left 1199782806 X:151078552-151078574 CCCATTTTACTTCTGAGTAAACA No data
Right 1199782811 X:151078583-151078605 GAAAAGCAGCAATCTAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199782806 Original CRISPR TGTTTACTCAGAAGTAAAAT GGG (reversed) Intergenic
No off target data available for this crispr