ID: 1199782808

View in Genome Browser
Species Human (GRCh38)
Location X:151078556-151078578
Sequence TTTTACTTCTGAGTAAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199782805_1199782808 -4 Left 1199782805 X:151078537-151078559 CCTAGGAGAATGTTTCCCATTTT No data
Right 1199782808 X:151078556-151078578 TTTTACTTCTGAGTAAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199782808 Original CRISPR TTTTACTTCTGAGTAAACAG AGG Intergenic
No off target data available for this crispr