ID: 1199782809

View in Genome Browser
Species Human (GRCh38)
Location X:151078579-151078601
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199782809_1199782814 1 Left 1199782809 X:151078579-151078601 CCTAGAAAAGCAGCAATCTAACC No data
Right 1199782814 X:151078603-151078625 GGGTCCCATAGGATAGTAGTAGG No data
1199782809_1199782812 -10 Left 1199782809 X:151078579-151078601 CCTAGAAAAGCAGCAATCTAACC No data
Right 1199782812 X:151078592-151078614 CAATCTAACCAGGGTCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199782809 Original CRISPR GGTTAGATTGCTGCTTTTCT AGG (reversed) Intergenic
No off target data available for this crispr