ID: 1199782810

View in Genome Browser
Species Human (GRCh38)
Location X:151078582-151078604
Sequence AGAAAAGCAGCAATCTAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199782807_1199782810 6 Left 1199782807 X:151078553-151078575 CCATTTTACTTCTGAGTAAACAG No data
Right 1199782810 X:151078582-151078604 AGAAAAGCAGCAATCTAACCAGG No data
1199782805_1199782810 22 Left 1199782805 X:151078537-151078559 CCTAGGAGAATGTTTCCCATTTT No data
Right 1199782810 X:151078582-151078604 AGAAAAGCAGCAATCTAACCAGG No data
1199782806_1199782810 7 Left 1199782806 X:151078552-151078574 CCCATTTTACTTCTGAGTAAACA No data
Right 1199782810 X:151078582-151078604 AGAAAAGCAGCAATCTAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199782810 Original CRISPR AGAAAAGCAGCAATCTAACC AGG Intergenic
No off target data available for this crispr