ID: 1199782812

View in Genome Browser
Species Human (GRCh38)
Location X:151078592-151078614
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199782807_1199782812 16 Left 1199782807 X:151078553-151078575 CCATTTTACTTCTGAGTAAACAG No data
Right 1199782812 X:151078592-151078614 CAATCTAACCAGGGTCCCATAGG No data
1199782806_1199782812 17 Left 1199782806 X:151078552-151078574 CCCATTTTACTTCTGAGTAAACA No data
Right 1199782812 X:151078592-151078614 CAATCTAACCAGGGTCCCATAGG No data
1199782809_1199782812 -10 Left 1199782809 X:151078579-151078601 CCTAGAAAAGCAGCAATCTAACC No data
Right 1199782812 X:151078592-151078614 CAATCTAACCAGGGTCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199782812 Original CRISPR CAATCTAACCAGGGTCCCAT AGG Intergenic
No off target data available for this crispr