ID: 1199783169

View in Genome Browser
Species Human (GRCh38)
Location X:151081943-151081965
Sequence CAGGACACACAGAAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199783162_1199783169 29 Left 1199783162 X:151081891-151081913 CCTAGCTGCCTTCAGAAGCTGCC No data
Right 1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG No data
1199783163_1199783169 21 Left 1199783163 X:151081899-151081921 CCTTCAGAAGCTGCCTGTTATTA No data
Right 1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG No data
1199783165_1199783169 8 Left 1199783165 X:151081912-151081934 CCTGTTATTAATGGCAGTCTCTG No data
Right 1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199783169 Original CRISPR CAGGACACACAGAAGGAGAA TGG Intergenic
No off target data available for this crispr