ID: 1199783655

View in Genome Browser
Species Human (GRCh38)
Location X:151084707-151084729
Sequence AGCTCATGGTGGGAGTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199783647_1199783655 19 Left 1199783647 X:151084665-151084687 CCAGGGAAAGGGCATAAATCAGT No data
Right 1199783655 X:151084707-151084729 AGCTCATGGTGGGAGTATGAAGG No data
1199783651_1199783655 -8 Left 1199783651 X:151084692-151084714 CCAGGGCAGCAGAGCAGCTCATG No data
Right 1199783655 X:151084707-151084729 AGCTCATGGTGGGAGTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199783655 Original CRISPR AGCTCATGGTGGGAGTATGA AGG Intergenic
No off target data available for this crispr