ID: 1199785056

View in Genome Browser
Species Human (GRCh38)
Location X:151097923-151097945
Sequence CTCACTAATCTCTACAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199785056_1199785060 16 Left 1199785056 X:151097923-151097945 CCTTCCTTGTAGAGATTAGTGAG No data
Right 1199785060 X:151097962-151097984 ACATGAGAACTGGTTGTTAAGGG No data
1199785056_1199785059 15 Left 1199785056 X:151097923-151097945 CCTTCCTTGTAGAGATTAGTGAG No data
Right 1199785059 X:151097961-151097983 CACATGAGAACTGGTTGTTAAGG No data
1199785056_1199785058 6 Left 1199785056 X:151097923-151097945 CCTTCCTTGTAGAGATTAGTGAG No data
Right 1199785058 X:151097952-151097974 CTTTGAGTTCACATGAGAACTGG No data
1199785056_1199785061 24 Left 1199785056 X:151097923-151097945 CCTTCCTTGTAGAGATTAGTGAG No data
Right 1199785061 X:151097970-151097992 ACTGGTTGTTAAGGGCAGTTAGG No data
1199785056_1199785062 25 Left 1199785056 X:151097923-151097945 CCTTCCTTGTAGAGATTAGTGAG No data
Right 1199785062 X:151097971-151097993 CTGGTTGTTAAGGGCAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199785056 Original CRISPR CTCACTAATCTCTACAAGGA AGG (reversed) Intergenic
No off target data available for this crispr