ID: 1199786728

View in Genome Browser
Species Human (GRCh38)
Location X:151112651-151112673
Sequence GAACTGCTTGGAGAAGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199786728_1199786734 11 Left 1199786728 X:151112651-151112673 CCTACCACTTCTCCAAGCAGTTC No data
Right 1199786734 X:151112685-151112707 TCAAGTGTCTGTGCCAGTCGTGG No data
1199786728_1199786737 28 Left 1199786728 X:151112651-151112673 CCTACCACTTCTCCAAGCAGTTC No data
Right 1199786737 X:151112702-151112724 TCGTGGGATCTCCTGCTGCCAGG No data
1199786728_1199786735 12 Left 1199786728 X:151112651-151112673 CCTACCACTTCTCCAAGCAGTTC No data
Right 1199786735 X:151112686-151112708 CAAGTGTCTGTGCCAGTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199786728 Original CRISPR GAACTGCTTGGAGAAGTGGT AGG (reversed) Intergenic
No off target data available for this crispr