ID: 1199786729

View in Genome Browser
Species Human (GRCh38)
Location X:151112655-151112677
Sequence GGGAGAACTGCTTGGAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199786729_1199786737 24 Left 1199786729 X:151112655-151112677 CCACTTCTCCAAGCAGTTCTCCC No data
Right 1199786737 X:151112702-151112724 TCGTGGGATCTCCTGCTGCCAGG No data
1199786729_1199786735 8 Left 1199786729 X:151112655-151112677 CCACTTCTCCAAGCAGTTCTCCC No data
Right 1199786735 X:151112686-151112708 CAAGTGTCTGTGCCAGTCGTGGG No data
1199786729_1199786734 7 Left 1199786729 X:151112655-151112677 CCACTTCTCCAAGCAGTTCTCCC No data
Right 1199786734 X:151112685-151112707 TCAAGTGTCTGTGCCAGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199786729 Original CRISPR GGGAGAACTGCTTGGAGAAG TGG (reversed) Intergenic
No off target data available for this crispr