ID: 1199786731

View in Genome Browser
Species Human (GRCh38)
Location X:151112675-151112697
Sequence CACAGACACTTGAGCTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199786731_1199786742 30 Left 1199786731 X:151112675-151112697 CCCTGCCAGCTCAAGTGTCTGTG No data
Right 1199786742 X:151112728-151112750 CCAGAAGTCCGTGGAGAGAGTGG No data
1199786731_1199786739 21 Left 1199786731 X:151112675-151112697 CCCTGCCAGCTCAAGTGTCTGTG No data
Right 1199786739 X:151112719-151112741 GCCAGGATTCCAGAAGTCCGTGG No data
1199786731_1199786737 4 Left 1199786731 X:151112675-151112697 CCCTGCCAGCTCAAGTGTCTGTG No data
Right 1199786737 X:151112702-151112724 TCGTGGGATCTCCTGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199786731 Original CRISPR CACAGACACTTGAGCTGGCA GGG (reversed) Intergenic
No off target data available for this crispr