ID: 1199786733

View in Genome Browser
Species Human (GRCh38)
Location X:151112680-151112702
Sequence ACTGGCACAGACACTTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199786733_1199786739 16 Left 1199786733 X:151112680-151112702 CCAGCTCAAGTGTCTGTGCCAGT No data
Right 1199786739 X:151112719-151112741 GCCAGGATTCCAGAAGTCCGTGG No data
1199786733_1199786743 26 Left 1199786733 X:151112680-151112702 CCAGCTCAAGTGTCTGTGCCAGT No data
Right 1199786743 X:151112729-151112751 CAGAAGTCCGTGGAGAGAGTGGG No data
1199786733_1199786742 25 Left 1199786733 X:151112680-151112702 CCAGCTCAAGTGTCTGTGCCAGT No data
Right 1199786742 X:151112728-151112750 CCAGAAGTCCGTGGAGAGAGTGG No data
1199786733_1199786737 -1 Left 1199786733 X:151112680-151112702 CCAGCTCAAGTGTCTGTGCCAGT No data
Right 1199786737 X:151112702-151112724 TCGTGGGATCTCCTGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199786733 Original CRISPR ACTGGCACAGACACTTGAGC TGG (reversed) Intergenic
No off target data available for this crispr