ID: 1199786735

View in Genome Browser
Species Human (GRCh38)
Location X:151112686-151112708
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199786727_1199786735 13 Left 1199786727 X:151112650-151112672 CCCTACCACTTCTCCAAGCAGTT No data
Right 1199786735 X:151112686-151112708 CAAGTGTCTGTGCCAGTCGTGGG No data
1199786725_1199786735 18 Left 1199786725 X:151112645-151112667 CCTGCCCCTACCACTTCTCCAAG No data
Right 1199786735 X:151112686-151112708 CAAGTGTCTGTGCCAGTCGTGGG No data
1199786730_1199786735 0 Left 1199786730 X:151112663-151112685 CCAAGCAGTTCTCCCTGCCAGCT No data
Right 1199786735 X:151112686-151112708 CAAGTGTCTGTGCCAGTCGTGGG No data
1199786726_1199786735 14 Left 1199786726 X:151112649-151112671 CCCCTACCACTTCTCCAAGCAGT No data
Right 1199786735 X:151112686-151112708 CAAGTGTCTGTGCCAGTCGTGGG No data
1199786728_1199786735 12 Left 1199786728 X:151112651-151112673 CCTACCACTTCTCCAAGCAGTTC No data
Right 1199786735 X:151112686-151112708 CAAGTGTCTGTGCCAGTCGTGGG No data
1199786729_1199786735 8 Left 1199786729 X:151112655-151112677 CCACTTCTCCAAGCAGTTCTCCC No data
Right 1199786735 X:151112686-151112708 CAAGTGTCTGTGCCAGTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199786735 Original CRISPR CAAGTGTCTGTGCCAGTCGT GGG Intergenic
No off target data available for this crispr