ID: 1199786737

View in Genome Browser
Species Human (GRCh38)
Location X:151112702-151112724
Sequence TCGTGGGATCTCCTGCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199786727_1199786737 29 Left 1199786727 X:151112650-151112672 CCCTACCACTTCTCCAAGCAGTT No data
Right 1199786737 X:151112702-151112724 TCGTGGGATCTCCTGCTGCCAGG No data
1199786726_1199786737 30 Left 1199786726 X:151112649-151112671 CCCCTACCACTTCTCCAAGCAGT No data
Right 1199786737 X:151112702-151112724 TCGTGGGATCTCCTGCTGCCAGG No data
1199786733_1199786737 -1 Left 1199786733 X:151112680-151112702 CCAGCTCAAGTGTCTGTGCCAGT No data
Right 1199786737 X:151112702-151112724 TCGTGGGATCTCCTGCTGCCAGG No data
1199786728_1199786737 28 Left 1199786728 X:151112651-151112673 CCTACCACTTCTCCAAGCAGTTC No data
Right 1199786737 X:151112702-151112724 TCGTGGGATCTCCTGCTGCCAGG No data
1199786729_1199786737 24 Left 1199786729 X:151112655-151112677 CCACTTCTCCAAGCAGTTCTCCC No data
Right 1199786737 X:151112702-151112724 TCGTGGGATCTCCTGCTGCCAGG No data
1199786731_1199786737 4 Left 1199786731 X:151112675-151112697 CCCTGCCAGCTCAAGTGTCTGTG No data
Right 1199786737 X:151112702-151112724 TCGTGGGATCTCCTGCTGCCAGG No data
1199786732_1199786737 3 Left 1199786732 X:151112676-151112698 CCTGCCAGCTCAAGTGTCTGTGC No data
Right 1199786737 X:151112702-151112724 TCGTGGGATCTCCTGCTGCCAGG No data
1199786730_1199786737 16 Left 1199786730 X:151112663-151112685 CCAAGCAGTTCTCCCTGCCAGCT No data
Right 1199786737 X:151112702-151112724 TCGTGGGATCTCCTGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199786737 Original CRISPR TCGTGGGATCTCCTGCTGCC AGG Intergenic
No off target data available for this crispr