ID: 1199786739

View in Genome Browser
Species Human (GRCh38)
Location X:151112719-151112741
Sequence GCCAGGATTCCAGAAGTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199786733_1199786739 16 Left 1199786733 X:151112680-151112702 CCAGCTCAAGTGTCTGTGCCAGT No data
Right 1199786739 X:151112719-151112741 GCCAGGATTCCAGAAGTCCGTGG No data
1199786731_1199786739 21 Left 1199786731 X:151112675-151112697 CCCTGCCAGCTCAAGTGTCTGTG No data
Right 1199786739 X:151112719-151112741 GCCAGGATTCCAGAAGTCCGTGG No data
1199786732_1199786739 20 Left 1199786732 X:151112676-151112698 CCTGCCAGCTCAAGTGTCTGTGC No data
Right 1199786739 X:151112719-151112741 GCCAGGATTCCAGAAGTCCGTGG No data
1199786736_1199786739 -2 Left 1199786736 X:151112698-151112720 CCAGTCGTGGGATCTCCTGCTGC No data
Right 1199786739 X:151112719-151112741 GCCAGGATTCCAGAAGTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199786739 Original CRISPR GCCAGGATTCCAGAAGTCCG TGG Intergenic
No off target data available for this crispr