ID: 1199786742

View in Genome Browser
Species Human (GRCh38)
Location X:151112728-151112750
Sequence CCAGAAGTCCGTGGAGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199786731_1199786742 30 Left 1199786731 X:151112675-151112697 CCCTGCCAGCTCAAGTGTCTGTG No data
Right 1199786742 X:151112728-151112750 CCAGAAGTCCGTGGAGAGAGTGG No data
1199786732_1199786742 29 Left 1199786732 X:151112676-151112698 CCTGCCAGCTCAAGTGTCTGTGC No data
Right 1199786742 X:151112728-151112750 CCAGAAGTCCGTGGAGAGAGTGG No data
1199786736_1199786742 7 Left 1199786736 X:151112698-151112720 CCAGTCGTGGGATCTCCTGCTGC No data
Right 1199786742 X:151112728-151112750 CCAGAAGTCCGTGGAGAGAGTGG No data
1199786733_1199786742 25 Left 1199786733 X:151112680-151112702 CCAGCTCAAGTGTCTGTGCCAGT No data
Right 1199786742 X:151112728-151112750 CCAGAAGTCCGTGGAGAGAGTGG No data
1199786738_1199786742 -8 Left 1199786738 X:151112713-151112735 CCTGCTGCCAGGATTCCAGAAGT No data
Right 1199786742 X:151112728-151112750 CCAGAAGTCCGTGGAGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199786742 Original CRISPR CCAGAAGTCCGTGGAGAGAG TGG Intergenic
No off target data available for this crispr