ID: 1199793387

View in Genome Browser
Species Human (GRCh38)
Location X:151175352-151175374
Sequence AGTTCCCCTGCGGTGCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199793387_1199793391 -10 Left 1199793387 X:151175352-151175374 CCTGGGCGCACCGCAGGGGAACT No data
Right 1199793391 X:151175365-151175387 CAGGGGAACTGTGACGCACGGGG No data
1199793387_1199793395 13 Left 1199793387 X:151175352-151175374 CCTGGGCGCACCGCAGGGGAACT No data
Right 1199793395 X:151175388-151175410 ACAGAGATCCGCGGTGTGGAGGG No data
1199793387_1199793392 4 Left 1199793387 X:151175352-151175374 CCTGGGCGCACCGCAGGGGAACT No data
Right 1199793392 X:151175379-151175401 CGCACGGGGACAGAGATCCGCGG No data
1199793387_1199793396 18 Left 1199793387 X:151175352-151175374 CCTGGGCGCACCGCAGGGGAACT No data
Right 1199793396 X:151175393-151175415 GATCCGCGGTGTGGAGGGCGAGG No data
1199793387_1199793401 22 Left 1199793387 X:151175352-151175374 CCTGGGCGCACCGCAGGGGAACT No data
Right 1199793401 X:151175397-151175419 CGCGGTGTGGAGGGCGAGGGGGG No data
1199793387_1199793400 21 Left 1199793387 X:151175352-151175374 CCTGGGCGCACCGCAGGGGAACT No data
Right 1199793400 X:151175396-151175418 CCGCGGTGTGGAGGGCGAGGGGG No data
1199793387_1199793393 9 Left 1199793387 X:151175352-151175374 CCTGGGCGCACCGCAGGGGAACT No data
Right 1199793393 X:151175384-151175406 GGGGACAGAGATCCGCGGTGTGG No data
1199793387_1199793398 20 Left 1199793387 X:151175352-151175374 CCTGGGCGCACCGCAGGGGAACT No data
Right 1199793398 X:151175395-151175417 TCCGCGGTGTGGAGGGCGAGGGG No data
1199793387_1199793402 25 Left 1199793387 X:151175352-151175374 CCTGGGCGCACCGCAGGGGAACT No data
Right 1199793402 X:151175400-151175422 GGTGTGGAGGGCGAGGGGGGAGG No data
1199793387_1199793397 19 Left 1199793387 X:151175352-151175374 CCTGGGCGCACCGCAGGGGAACT No data
Right 1199793397 X:151175394-151175416 ATCCGCGGTGTGGAGGGCGAGGG No data
1199793387_1199793394 12 Left 1199793387 X:151175352-151175374 CCTGGGCGCACCGCAGGGGAACT No data
Right 1199793394 X:151175387-151175409 GACAGAGATCCGCGGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199793387 Original CRISPR AGTTCCCCTGCGGTGCGCCC AGG (reversed) Intergenic
No off target data available for this crispr