ID: 1199793388

View in Genome Browser
Species Human (GRCh38)
Location X:151175362-151175384
Sequence CGTGCGTCACAGTTCCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199793388_1199793406 30 Left 1199793388 X:151175362-151175384 CCGCAGGGGAACTGTGACGCACG No data
Right 1199793406 X:151175415-151175437 GGGGGAGGCCTGAGAGGGATGGG No data
1199793388_1199793392 -6 Left 1199793388 X:151175362-151175384 CCGCAGGGGAACTGTGACGCACG No data
Right 1199793392 X:151175379-151175401 CGCACGGGGACAGAGATCCGCGG No data
1199793388_1199793396 8 Left 1199793388 X:151175362-151175384 CCGCAGGGGAACTGTGACGCACG No data
Right 1199793396 X:151175393-151175415 GATCCGCGGTGTGGAGGGCGAGG No data
1199793388_1199793405 29 Left 1199793388 X:151175362-151175384 CCGCAGGGGAACTGTGACGCACG No data
Right 1199793405 X:151175414-151175436 GGGGGGAGGCCTGAGAGGGATGG No data
1199793388_1199793403 24 Left 1199793388 X:151175362-151175384 CCGCAGGGGAACTGTGACGCACG No data
Right 1199793403 X:151175409-151175431 GGCGAGGGGGGAGGCCTGAGAGG No data
1199793388_1199793397 9 Left 1199793388 X:151175362-151175384 CCGCAGGGGAACTGTGACGCACG No data
Right 1199793397 X:151175394-151175416 ATCCGCGGTGTGGAGGGCGAGGG No data
1199793388_1199793394 2 Left 1199793388 X:151175362-151175384 CCGCAGGGGAACTGTGACGCACG No data
Right 1199793394 X:151175387-151175409 GACAGAGATCCGCGGTGTGGAGG No data
1199793388_1199793402 15 Left 1199793388 X:151175362-151175384 CCGCAGGGGAACTGTGACGCACG No data
Right 1199793402 X:151175400-151175422 GGTGTGGAGGGCGAGGGGGGAGG No data
1199793388_1199793398 10 Left 1199793388 X:151175362-151175384 CCGCAGGGGAACTGTGACGCACG No data
Right 1199793398 X:151175395-151175417 TCCGCGGTGTGGAGGGCGAGGGG No data
1199793388_1199793400 11 Left 1199793388 X:151175362-151175384 CCGCAGGGGAACTGTGACGCACG No data
Right 1199793400 X:151175396-151175418 CCGCGGTGTGGAGGGCGAGGGGG No data
1199793388_1199793401 12 Left 1199793388 X:151175362-151175384 CCGCAGGGGAACTGTGACGCACG No data
Right 1199793401 X:151175397-151175419 CGCGGTGTGGAGGGCGAGGGGGG No data
1199793388_1199793393 -1 Left 1199793388 X:151175362-151175384 CCGCAGGGGAACTGTGACGCACG No data
Right 1199793393 X:151175384-151175406 GGGGACAGAGATCCGCGGTGTGG No data
1199793388_1199793404 25 Left 1199793388 X:151175362-151175384 CCGCAGGGGAACTGTGACGCACG No data
Right 1199793404 X:151175410-151175432 GCGAGGGGGGAGGCCTGAGAGGG No data
1199793388_1199793395 3 Left 1199793388 X:151175362-151175384 CCGCAGGGGAACTGTGACGCACG No data
Right 1199793395 X:151175388-151175410 ACAGAGATCCGCGGTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199793388 Original CRISPR CGTGCGTCACAGTTCCCCTG CGG (reversed) Intergenic
No off target data available for this crispr