ID: 1199793397

View in Genome Browser
Species Human (GRCh38)
Location X:151175394-151175416
Sequence ATCCGCGGTGTGGAGGGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199793387_1199793397 19 Left 1199793387 X:151175352-151175374 CCTGGGCGCACCGCAGGGGAACT No data
Right 1199793397 X:151175394-151175416 ATCCGCGGTGTGGAGGGCGAGGG No data
1199793388_1199793397 9 Left 1199793388 X:151175362-151175384 CCGCAGGGGAACTGTGACGCACG No data
Right 1199793397 X:151175394-151175416 ATCCGCGGTGTGGAGGGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199793397 Original CRISPR ATCCGCGGTGTGGAGGGCGA GGG Intergenic
No off target data available for this crispr