ID: 1199793539

View in Genome Browser
Species Human (GRCh38)
Location X:151176046-151176068
Sequence TCTGTGTCCCGCGGGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199793539_1199793553 14 Left 1199793539 X:151176046-151176068 CCCTGTTCCCCGCGGGACACAGA No data
Right 1199793553 X:151176083-151176105 CAAGGGCATGGGGCGTGGGATGG No data
1199793539_1199793545 -9 Left 1199793539 X:151176046-151176068 CCCTGTTCCCCGCGGGACACAGA No data
Right 1199793545 X:151176060-151176082 GGACACAGAAGGCTCTAGACAGG No data
1199793539_1199793549 3 Left 1199793539 X:151176046-151176068 CCCTGTTCCCCGCGGGACACAGA No data
Right 1199793549 X:151176072-151176094 CTCTAGACAGGCAAGGGCATGGG No data
1199793539_1199793552 10 Left 1199793539 X:151176046-151176068 CCCTGTTCCCCGCGGGACACAGA No data
Right 1199793552 X:151176079-151176101 CAGGCAAGGGCATGGGGCGTGGG No data
1199793539_1199793554 25 Left 1199793539 X:151176046-151176068 CCCTGTTCCCCGCGGGACACAGA No data
Right 1199793554 X:151176094-151176116 GGCGTGGGATGGACCTCACAAGG No data
1199793539_1199793548 2 Left 1199793539 X:151176046-151176068 CCCTGTTCCCCGCGGGACACAGA No data
Right 1199793548 X:151176071-151176093 GCTCTAGACAGGCAAGGGCATGG No data
1199793539_1199793551 9 Left 1199793539 X:151176046-151176068 CCCTGTTCCCCGCGGGACACAGA No data
Right 1199793551 X:151176078-151176100 ACAGGCAAGGGCATGGGGCGTGG No data
1199793539_1199793547 -3 Left 1199793539 X:151176046-151176068 CCCTGTTCCCCGCGGGACACAGA No data
Right 1199793547 X:151176066-151176088 AGAAGGCTCTAGACAGGCAAGGG No data
1199793539_1199793546 -4 Left 1199793539 X:151176046-151176068 CCCTGTTCCCCGCGGGACACAGA No data
Right 1199793546 X:151176065-151176087 CAGAAGGCTCTAGACAGGCAAGG No data
1199793539_1199793550 4 Left 1199793539 X:151176046-151176068 CCCTGTTCCCCGCGGGACACAGA No data
Right 1199793550 X:151176073-151176095 TCTAGACAGGCAAGGGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199793539 Original CRISPR TCTGTGTCCCGCGGGGAACA GGG (reversed) Intergenic
No off target data available for this crispr