ID: 1199794035

View in Genome Browser
Species Human (GRCh38)
Location X:151178154-151178176
Sequence CCTGCCCGGGAGAATCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199794035_1199794056 26 Left 1199794035 X:151178154-151178176 CCAGCTGGATTCTCCCGGGCAGG No data
Right 1199794056 X:151178203-151178225 TCTGGGGGATTACTTTGCTTGGG No data
1199794035_1199794053 11 Left 1199794035 X:151178154-151178176 CCAGCTGGATTCTCCCGGGCAGG No data
Right 1199794053 X:151178188-151178210 AGGTGGCGGCCGGGGTCTGGGGG No data
1199794035_1199794045 -6 Left 1199794035 X:151178154-151178176 CCAGCTGGATTCTCCCGGGCAGG No data
Right 1199794045 X:151178171-151178193 GGCAGGGCGTGGGGGAGAGGTGG No data
1199794035_1199794047 1 Left 1199794035 X:151178154-151178176 CCAGCTGGATTCTCCCGGGCAGG No data
Right 1199794047 X:151178178-151178200 CGTGGGGGAGAGGTGGCGGCCGG No data
1199794035_1199794051 9 Left 1199794035 X:151178154-151178176 CCAGCTGGATTCTCCCGGGCAGG No data
Right 1199794051 X:151178186-151178208 AGAGGTGGCGGCCGGGGTCTGGG No data
1199794035_1199794046 -3 Left 1199794035 X:151178154-151178176 CCAGCTGGATTCTCCCGGGCAGG No data
Right 1199794046 X:151178174-151178196 AGGGCGTGGGGGAGAGGTGGCGG No data
1199794035_1199794048 2 Left 1199794035 X:151178154-151178176 CCAGCTGGATTCTCCCGGGCAGG No data
Right 1199794048 X:151178179-151178201 GTGGGGGAGAGGTGGCGGCCGGG No data
1199794035_1199794050 8 Left 1199794035 X:151178154-151178176 CCAGCTGGATTCTCCCGGGCAGG No data
Right 1199794050 X:151178185-151178207 GAGAGGTGGCGGCCGGGGTCTGG No data
1199794035_1199794049 3 Left 1199794035 X:151178154-151178176 CCAGCTGGATTCTCCCGGGCAGG No data
Right 1199794049 X:151178180-151178202 TGGGGGAGAGGTGGCGGCCGGGG No data
1199794035_1199794052 10 Left 1199794035 X:151178154-151178176 CCAGCTGGATTCTCCCGGGCAGG No data
Right 1199794052 X:151178187-151178209 GAGGTGGCGGCCGGGGTCTGGGG No data
1199794035_1199794044 -9 Left 1199794035 X:151178154-151178176 CCAGCTGGATTCTCCCGGGCAGG No data
Right 1199794044 X:151178168-151178190 CCGGGCAGGGCGTGGGGGAGAGG No data
1199794035_1199794055 25 Left 1199794035 X:151178154-151178176 CCAGCTGGATTCTCCCGGGCAGG No data
Right 1199794055 X:151178202-151178224 GTCTGGGGGATTACTTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199794035 Original CRISPR CCTGCCCGGGAGAATCCAGC TGG (reversed) Intronic