ID: 1199794592

View in Genome Browser
Species Human (GRCh38)
Location X:151181817-151181839
Sequence TCCCATTCCCCGAGGGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199794585_1199794592 -4 Left 1199794585 X:151181798-151181820 CCTTGTTCCTGCTTTCTTCTCCC No data
Right 1199794592 X:151181817-151181839 TCCCATTCCCCGAGGGGGTTGGG No data
1199794584_1199794592 2 Left 1199794584 X:151181792-151181814 CCTCTGCCTTGTTCCTGCTTTCT No data
Right 1199794592 X:151181817-151181839 TCCCATTCCCCGAGGGGGTTGGG No data
1199794577_1199794592 24 Left 1199794577 X:151181770-151181792 CCCTCCTCCCCTTTCCTCATTTC No data
Right 1199794592 X:151181817-151181839 TCCCATTCCCCGAGGGGGTTGGG No data
1199794581_1199794592 16 Left 1199794581 X:151181778-151181800 CCCTTTCCTCATTTCCTCTGCCT No data
Right 1199794592 X:151181817-151181839 TCCCATTCCCCGAGGGGGTTGGG No data
1199794579_1199794592 20 Left 1199794579 X:151181774-151181796 CCTCCCCTTTCCTCATTTCCTCT No data
Right 1199794592 X:151181817-151181839 TCCCATTCCCCGAGGGGGTTGGG No data
1199794578_1199794592 23 Left 1199794578 X:151181771-151181793 CCTCCTCCCCTTTCCTCATTTCC No data
Right 1199794592 X:151181817-151181839 TCCCATTCCCCGAGGGGGTTGGG No data
1199794580_1199794592 17 Left 1199794580 X:151181777-151181799 CCCCTTTCCTCATTTCCTCTGCC No data
Right 1199794592 X:151181817-151181839 TCCCATTCCCCGAGGGGGTTGGG No data
1199794583_1199794592 10 Left 1199794583 X:151181784-151181806 CCTCATTTCCTCTGCCTTGTTCC No data
Right 1199794592 X:151181817-151181839 TCCCATTCCCCGAGGGGGTTGGG No data
1199794582_1199794592 15 Left 1199794582 X:151181779-151181801 CCTTTCCTCATTTCCTCTGCCTT No data
Right 1199794592 X:151181817-151181839 TCCCATTCCCCGAGGGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199794592 Original CRISPR TCCCATTCCCCGAGGGGGTT GGG Intergenic
No off target data available for this crispr