ID: 1199795391

View in Genome Browser
Species Human (GRCh38)
Location X:151191016-151191038
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199795391_1199795393 5 Left 1199795391 X:151191016-151191038 CCCAGGCAGTACTGCATGGCTCA No data
Right 1199795393 X:151191044-151191066 AGAATCTGTGTGCTTAAAAGAGG No data
1199795391_1199795395 24 Left 1199795391 X:151191016-151191038 CCCAGGCAGTACTGCATGGCTCA No data
Right 1199795395 X:151191063-151191085 GAGGGAGAGCAAAGTGATTGCGG No data
1199795391_1199795394 6 Left 1199795391 X:151191016-151191038 CCCAGGCAGTACTGCATGGCTCA No data
Right 1199795394 X:151191045-151191067 GAATCTGTGTGCTTAAAAGAGGG No data
1199795391_1199795396 25 Left 1199795391 X:151191016-151191038 CCCAGGCAGTACTGCATGGCTCA No data
Right 1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199795391 Original CRISPR TGAGCCATGCAGTACTGCCT GGG (reversed) Intergenic
No off target data available for this crispr