ID: 1199795396

View in Genome Browser
Species Human (GRCh38)
Location X:151191064-151191086
Sequence AGGGAGAGCAAAGTGATTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199795391_1199795396 25 Left 1199795391 X:151191016-151191038 CCCAGGCAGTACTGCATGGCTCA No data
Right 1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG No data
1199795392_1199795396 24 Left 1199795392 X:151191017-151191039 CCAGGCAGTACTGCATGGCTCAG No data
Right 1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG No data
1199795390_1199795396 26 Left 1199795390 X:151191015-151191037 CCCCAGGCAGTACTGCATGGCTC No data
Right 1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199795396 Original CRISPR AGGGAGAGCAAAGTGATTGC GGG Intergenic
No off target data available for this crispr