ID: 1199795597

View in Genome Browser
Species Human (GRCh38)
Location X:151192301-151192323
Sequence AGGTGCCACCTGGACAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199795597_1199795600 9 Left 1199795597 X:151192301-151192323 CCAACACTGTCCAGGTGGCACCT No data
Right 1199795600 X:151192333-151192355 TGCAAAAATCACAGAATTACTGG No data
1199795597_1199795601 10 Left 1199795597 X:151192301-151192323 CCAACACTGTCCAGGTGGCACCT No data
Right 1199795601 X:151192334-151192356 GCAAAAATCACAGAATTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199795597 Original CRISPR AGGTGCCACCTGGACAGTGT TGG (reversed) Intergenic
No off target data available for this crispr