ID: 1199799910

View in Genome Browser
Species Human (GRCh38)
Location X:151240323-151240345
Sequence CTGTATTAGGAAAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199799910_1199799915 -1 Left 1199799910 X:151240323-151240345 CCTCCCTCCTTTTCCTAATACAG No data
Right 1199799915 X:151240345-151240367 GTAAAACTCAATGATTGTTGTGG No data
1199799910_1199799916 19 Left 1199799910 X:151240323-151240345 CCTCCCTCCTTTTCCTAATACAG No data
Right 1199799916 X:151240365-151240387 TGGTTAATTCTTGCTCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199799910 Original CRISPR CTGTATTAGGAAAAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr