ID: 1199800269

View in Genome Browser
Species Human (GRCh38)
Location X:151243806-151243828
Sequence ATATATATACATATGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199800269_1199800270 5 Left 1199800269 X:151243806-151243828 CCTAGCTTCATATGTATATATAT No data
Right 1199800270 X:151243834-151243856 CGTGTGTGTCTGTGTGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199800269 Original CRISPR ATATATATACATATGAAGCT AGG (reversed) Intergenic
No off target data available for this crispr