ID: 1199811246

View in Genome Browser
Species Human (GRCh38)
Location X:151351910-151351932
Sequence TGCAATCATATGGATGGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199811246_1199811251 6 Left 1199811246 X:151351910-151351932 CCCATTCCATCCATATGATTGCA No data
Right 1199811251 X:151351939-151351961 ATGGAATGTAGATGATTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199811246 Original CRISPR TGCAATCATATGGATGGAAT GGG (reversed) Intergenic
No off target data available for this crispr