ID: 1199815885

View in Genome Browser
Species Human (GRCh38)
Location X:151396794-151396816
Sequence AGCCAGAGGGCTGTGGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 300}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199815885_1199815890 -5 Left 1199815885 X:151396794-151396816 CCTAGCACCACAGCCCTCTGGCT 0: 1
1: 0
2: 2
3: 32
4: 300
Right 1199815890 X:151396812-151396834 TGGCTGGTAGTCCCTCTTCGCGG 0: 1
1: 0
2: 0
3: 7
4: 88
1199815885_1199815893 8 Left 1199815885 X:151396794-151396816 CCTAGCACCACAGCCCTCTGGCT 0: 1
1: 0
2: 2
3: 32
4: 300
Right 1199815893 X:151396825-151396847 CTCTTCGCGGCTCATATGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 33
1199815885_1199815895 20 Left 1199815885 X:151396794-151396816 CCTAGCACCACAGCCCTCTGGCT 0: 1
1: 0
2: 2
3: 32
4: 300
Right 1199815895 X:151396837-151396859 CATATGCTCGGGTCTCCTTGCGG 0: 1
1: 0
2: 1
3: 13
4: 114
1199815885_1199815894 9 Left 1199815885 X:151396794-151396816 CCTAGCACCACAGCCCTCTGGCT 0: 1
1: 0
2: 2
3: 32
4: 300
Right 1199815894 X:151396826-151396848 TCTTCGCGGCTCATATGCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199815885 Original CRISPR AGCCAGAGGGCTGTGGTGCT AGG (reversed) Intronic