ID: 1199815887

View in Genome Browser
Species Human (GRCh38)
Location X:151396801-151396823
Sequence GACTACCAGCCAGAGGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199815887_1199815895 13 Left 1199815887 X:151396801-151396823 CCACAGCCCTCTGGCTGGTAGTC 0: 1
1: 0
2: 2
3: 17
4: 236
Right 1199815895 X:151396837-151396859 CATATGCTCGGGTCTCCTTGCGG 0: 1
1: 0
2: 1
3: 13
4: 114
1199815887_1199815893 1 Left 1199815887 X:151396801-151396823 CCACAGCCCTCTGGCTGGTAGTC 0: 1
1: 0
2: 2
3: 17
4: 236
Right 1199815893 X:151396825-151396847 CTCTTCGCGGCTCATATGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 33
1199815887_1199815894 2 Left 1199815887 X:151396801-151396823 CCACAGCCCTCTGGCTGGTAGTC 0: 1
1: 0
2: 2
3: 17
4: 236
Right 1199815894 X:151396826-151396848 TCTTCGCGGCTCATATGCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199815887 Original CRISPR GACTACCAGCCAGAGGGCTG TGG (reversed) Intronic