ID: 1199815889

View in Genome Browser
Species Human (GRCh38)
Location X:151396808-151396830
Sequence GAAGAGGGACTACCAGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199815889_1199815893 -6 Left 1199815889 X:151396808-151396830 CCTCTGGCTGGTAGTCCCTCTTC 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1199815893 X:151396825-151396847 CTCTTCGCGGCTCATATGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 33
1199815889_1199815894 -5 Left 1199815889 X:151396808-151396830 CCTCTGGCTGGTAGTCCCTCTTC 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1199815894 X:151396826-151396848 TCTTCGCGGCTCATATGCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1199815889_1199815895 6 Left 1199815889 X:151396808-151396830 CCTCTGGCTGGTAGTCCCTCTTC 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1199815895 X:151396837-151396859 CATATGCTCGGGTCTCCTTGCGG 0: 1
1: 0
2: 1
3: 13
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199815889 Original CRISPR GAAGAGGGACTACCAGCCAG AGG (reversed) Intronic