ID: 1199815891 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:151396823-151396845 |
| Sequence | GAGCATATGAGCCGCGAAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 43 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 41} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1199815891_1199815901 | 23 | Left | 1199815891 | X:151396823-151396845 | CCCTCTTCGCGGCTCATATGCTC | 0: 1 1: 0 2: 0 3: 1 4: 41 |
||
| Right | 1199815901 | X:151396869-151396891 | CAGCGACCGAGACGCAGACGAGG | 0: 1 1: 0 2: 0 3: 1 4: 47 |
||||
| 1199815891_1199815895 | -9 | Left | 1199815891 | X:151396823-151396845 | CCCTCTTCGCGGCTCATATGCTC | 0: 1 1: 0 2: 0 3: 1 4: 41 |
||
| Right | 1199815895 | X:151396837-151396859 | CATATGCTCGGGTCTCCTTGCGG | 0: 1 1: 0 2: 1 3: 13 4: 114 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1199815891 | Original CRISPR | GAGCATATGAGCCGCGAAGA GGG (reversed) | Intronic | ||