ID: 1199815892

View in Genome Browser
Species Human (GRCh38)
Location X:151396824-151396846
Sequence CGAGCATATGAGCCGCGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 10}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199815892_1199815901 22 Left 1199815892 X:151396824-151396846 CCTCTTCGCGGCTCATATGCTCG 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1199815901 X:151396869-151396891 CAGCGACCGAGACGCAGACGAGG 0: 1
1: 0
2: 0
3: 1
4: 47
1199815892_1199815895 -10 Left 1199815892 X:151396824-151396846 CCTCTTCGCGGCTCATATGCTCG 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1199815895 X:151396837-151396859 CATATGCTCGGGTCTCCTTGCGG 0: 1
1: 0
2: 1
3: 13
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199815892 Original CRISPR CGAGCATATGAGCCGCGAAG AGG (reversed) Intronic