ID: 1199815895

View in Genome Browser
Species Human (GRCh38)
Location X:151396837-151396859
Sequence CATATGCTCGGGTCTCCTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199815885_1199815895 20 Left 1199815885 X:151396794-151396816 CCTAGCACCACAGCCCTCTGGCT 0: 1
1: 0
2: 2
3: 32
4: 300
Right 1199815895 X:151396837-151396859 CATATGCTCGGGTCTCCTTGCGG 0: 1
1: 0
2: 1
3: 13
4: 114
1199815892_1199815895 -10 Left 1199815892 X:151396824-151396846 CCTCTTCGCGGCTCATATGCTCG 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1199815895 X:151396837-151396859 CATATGCTCGGGTCTCCTTGCGG 0: 1
1: 0
2: 1
3: 13
4: 114
1199815887_1199815895 13 Left 1199815887 X:151396801-151396823 CCACAGCCCTCTGGCTGGTAGTC 0: 1
1: 0
2: 2
3: 17
4: 236
Right 1199815895 X:151396837-151396859 CATATGCTCGGGTCTCCTTGCGG 0: 1
1: 0
2: 1
3: 13
4: 114
1199815888_1199815895 7 Left 1199815888 X:151396807-151396829 CCCTCTGGCTGGTAGTCCCTCTT 0: 1
1: 0
2: 1
3: 11
4: 214
Right 1199815895 X:151396837-151396859 CATATGCTCGGGTCTCCTTGCGG 0: 1
1: 0
2: 1
3: 13
4: 114
1199815891_1199815895 -9 Left 1199815891 X:151396823-151396845 CCCTCTTCGCGGCTCATATGCTC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1199815895 X:151396837-151396859 CATATGCTCGGGTCTCCTTGCGG 0: 1
1: 0
2: 1
3: 13
4: 114
1199815889_1199815895 6 Left 1199815889 X:151396808-151396830 CCTCTGGCTGGTAGTCCCTCTTC 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1199815895 X:151396837-151396859 CATATGCTCGGGTCTCCTTGCGG 0: 1
1: 0
2: 1
3: 13
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199815895 Original CRISPR CATATGCTCGGGTCTCCTTG CGG Intronic