ID: 1199815901

View in Genome Browser
Species Human (GRCh38)
Location X:151396869-151396891
Sequence CAGCGACCGAGACGCAGACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199815891_1199815901 23 Left 1199815891 X:151396823-151396845 CCCTCTTCGCGGCTCATATGCTC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1199815901 X:151396869-151396891 CAGCGACCGAGACGCAGACGAGG 0: 1
1: 0
2: 0
3: 1
4: 47
1199815892_1199815901 22 Left 1199815892 X:151396824-151396846 CCTCTTCGCGGCTCATATGCTCG 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1199815901 X:151396869-151396891 CAGCGACCGAGACGCAGACGAGG 0: 1
1: 0
2: 0
3: 1
4: 47
1199815896_1199815901 -6 Left 1199815896 X:151396852-151396874 CCTTGCGGCCCCCAGCTCAGCGA 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1199815901 X:151396869-151396891 CAGCGACCGAGACGCAGACGAGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199815901 Original CRISPR CAGCGACCGAGACGCAGACG AGG Intronic