ID: 1199816003

View in Genome Browser
Species Human (GRCh38)
Location X:151397340-151397362
Sequence CACTGCAGCCTCCTGAGTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1227
Summary {0: 1, 1: 0, 2: 20, 3: 155, 4: 1051}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199815996_1199816003 24 Left 1199815996 X:151397293-151397315 CCGGCACGGCTACACCATGGAGC 0: 1
1: 0
2: 1
3: 5
4: 79
Right 1199816003 X:151397340-151397362 CACTGCAGCCTCCTGAGTTCAGG 0: 1
1: 0
2: 20
3: 155
4: 1051
1199815999_1199816003 10 Left 1199815999 X:151397307-151397329 CCATGGAGCGCCCGGATAAGGCG 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1199816003 X:151397340-151397362 CACTGCAGCCTCCTGAGTTCAGG 0: 1
1: 0
2: 20
3: 155
4: 1051
1199816001_1199816003 0 Left 1199816001 X:151397317-151397339 CCCGGATAAGGCGGCGCTGAACG 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1199816003 X:151397340-151397362 CACTGCAGCCTCCTGAGTTCAGG 0: 1
1: 0
2: 20
3: 155
4: 1051
1199816002_1199816003 -1 Left 1199816002 X:151397318-151397340 CCGGATAAGGCGGCGCTGAACGC 0: 1
1: 0
2: 1
3: 1
4: 15
Right 1199816003 X:151397340-151397362 CACTGCAGCCTCCTGAGTTCAGG 0: 1
1: 0
2: 20
3: 155
4: 1051
1199815994_1199816003 30 Left 1199815994 X:151397287-151397309 CCTGTGCCGGCACGGCTACACCA 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1199816003 X:151397340-151397362 CACTGCAGCCTCCTGAGTTCAGG 0: 1
1: 0
2: 20
3: 155
4: 1051

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199816003 Original CRISPR CACTGCAGCCTCCTGAGTTC AGG Exonic
900291656 1:1926277-1926299 CACTCCAGCCTGCTGCGTGCAGG - Exonic
900358643 1:2276990-2277012 CACAGCAGCCTCCTGGGTGAGGG - Intronic
900616221 1:3566835-3566857 CACTGCTGCCTCCTGAGTCTGGG - Intronic
900633335 1:3650095-3650117 CACTTCCGCCTTCTGACTTCCGG - Intronic
900694982 1:4004231-4004253 CACTGCAGGCTCCTGAGGGCGGG + Intergenic
901230549 1:7639655-7639677 CACTTCAGCCTCCTGAGGCTGGG - Intronic
901263249 1:7889326-7889348 CACTTCAGCTTCCTGAGTAGCGG - Intergenic
901300599 1:8197613-8197635 CACTTCAGCCTCCCGAGTCATGG - Intergenic
901302121 1:8207366-8207388 CACTGCAGCCTCCACATTCCAGG - Intergenic
901818779 1:11811998-11812020 CACCTCAGCCTCCTGAGTAGTGG - Intronic
901883771 1:12208832-12208854 CCCCTCAGCCTCCTGAGTACAGG - Exonic
902118978 1:14145328-14145350 CACCTCAGCCTCCTGAGAGCTGG - Intergenic
902139548 1:14341402-14341424 CACTGCAGCACCCTGAGCCCAGG - Intergenic
902140280 1:14347997-14348019 CACCTCAGCCTCCTGAGAGCTGG + Intergenic
902200557 1:14830428-14830450 CTCTGCAGGCTCCTGAGGGCTGG - Intronic
902321368 1:15669418-15669440 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
902507786 1:16948972-16948994 GACTGCAGCCTCCCAAGGTCTGG + Intronic
902558932 1:17264893-17264915 CACTTCAGCCTCCTGAGGCTGGG - Intronic
902559597 1:17268959-17268981 CACTGCAGCCTCCACCTTTCAGG + Intronic
903176490 1:21584580-21584602 CACCTCAGTCTCCTGAGTGCAGG - Intergenic
903241135 1:21983461-21983483 CACTGCAGCCTCCTGGGCCAAGG - Intronic
903244645 1:22006639-22006661 CACTGCAGCCTCCTGGGCCAAGG - Intronic
903329291 1:22588944-22588966 CACTGCGGCCACCTGGGTCCAGG - Exonic
903369783 1:22827819-22827841 CTCTGCAGTCGCCTGAGTCCTGG - Intronic
903477677 1:23631048-23631070 CACCTCAGCCTCCTGAGTCTGGG - Intronic
903855329 1:26334308-26334330 TACTTCAGCCTCCTGAGACCTGG - Intronic
903878504 1:26492679-26492701 GACTGAGGCCTCCTGAGGTCAGG + Intergenic
904027757 1:27515305-27515327 CACCTCAGCCTCCTGAGTAGAGG - Intergenic
904102505 1:28043754-28043776 AACTTCTGCCTCCTGAGTTCAGG - Intronic
904129386 1:28264235-28264257 AACCTCCGCCTCCTGAGTTCAGG - Intronic
904389688 1:30174079-30174101 CTCTGGAGCCTCCTGAGTACAGG + Intergenic
904502872 1:30926581-30926603 CACTGCAGCCTTCTGCCTCCTGG - Intergenic
904541533 1:31237002-31237024 CACTTCAGCCTCCCAAGTGCTGG - Intronic
904664473 1:32109242-32109264 CACTGCAACCTCCTGCCTCCCGG + Intronic
904738851 1:32656268-32656290 CACTGCAGCCTCCGCCTTTCGGG + Intronic
904748882 1:32728446-32728468 CACTGCAACCTCCTGCCTCCCGG - Intergenic
905056162 1:35095841-35095863 CAGTTCATTCTCCTGAGTTCTGG - Exonic
905141561 1:35849571-35849593 CACCTCAGCCTCCTGAGTAGCGG - Intronic
905420787 1:37842151-37842173 CACCTCAGCCTCCTAAGTGCTGG - Intronic
905435238 1:37951231-37951253 CACTGCAGCCTGCAGGGGTCTGG + Intergenic
905955945 1:41996142-41996164 CACCTCAGCCTCCTGATTGCTGG - Intronic
905976924 1:42182577-42182599 AACTTCTGCCTCCTGGGTTCGGG + Intronic
906035690 1:42749017-42749039 CACTGCCACTTCCTGAGTTTAGG + Intronic
906230553 1:44159261-44159283 CACTTCAGCCTCCTGATAACTGG + Intergenic
906401496 1:45508067-45508089 CACTGGAGCCTCCCAAGTTAAGG + Intronic
906610129 1:47195679-47195701 AACTTCTGCCTCCTGGGTTCAGG - Intergenic
906943408 1:50275589-50275611 CCCTGCAGCCTCCCCAGTGCGGG + Intergenic
907031880 1:51180500-51180522 CACCTCAGCCTCCTGAGTACTGG + Intergenic
907044539 1:51292068-51292090 CACTTCAGCCTCCTGACTACAGG - Intronic
907061472 1:51430490-51430512 CACTGCAGCCTCCATCTTTCAGG - Intronic
907132233 1:52107323-52107345 AACTACTGCCTCCTGGGTTCAGG - Intergenic
907177488 1:52538531-52538553 CACTTCAGCCTCCTGAGACTGGG - Intronic
907177781 1:52541122-52541144 CTCTGCCTCCTCCTGGGTTCAGG - Intronic
907214321 1:52849437-52849459 CACTGCAGCCTCCTGCCTCCCGG + Intronic
908085020 1:60622704-60622726 CACTCCAGCCTCCTGAGCTGAGG - Intergenic
908217112 1:61965034-61965056 CACTGCAGCCTCCACCTTTCGGG - Intronic
908228455 1:62079944-62079966 AACTTCTGCCTCCTGGGTTCAGG - Intronic
908246222 1:62229453-62229475 CAATCCAGCCTCCTAAGGTCTGG - Intergenic
908316594 1:62939006-62939028 AACTCCAGCCTGCTGACTTCAGG - Intergenic
908545633 1:65159573-65159595 CACTGTAGCCTCCTGGACTCAGG - Intronic
908807618 1:67947246-67947268 GGCTGCAGCCTCCTGAGTCTGGG - Intergenic
908848249 1:68347133-68347155 CACTGCAACCTCCTGCTCTCGGG + Intergenic
909658173 1:78053814-78053836 CACCTCAGCCTCCTGAATACTGG - Intronic
909902086 1:81150434-81150456 CACTTCAGCCTCCAGAGTGGTGG - Intergenic
910038540 1:82818893-82818915 CTCTGCACCCTCCTCACTTCTGG - Intergenic
910146960 1:84091583-84091605 AACTGCTGCCTCCTGATCTCAGG + Intronic
910185038 1:84529936-84529958 AACTTCCGCCTCCTGGGTTCAGG + Intergenic
910922882 1:92368295-92368317 AACTTCTGCCTCCTGGGTTCAGG - Intronic
910954989 1:92693267-92693289 CACATCAGCTTCCTGAGTACAGG - Intronic
911150464 1:94593195-94593217 CACTGCAGCCTCCAGACTTCTGG + Intergenic
911151048 1:94597022-94597044 AACCTCTGCCTCCTGAGTTCAGG + Intergenic
911288662 1:96028635-96028657 CTCTCCAGTCTCCTGTGTTCGGG + Intergenic
911502512 1:98705825-98705847 CACTGCCACCTCTTCAGTTCAGG - Intronic
912265432 1:108152478-108152500 CACCTCAGCATCCTGAGTACAGG + Intronic
912309228 1:108602796-108602818 CACTGCAGCCTTCTGGGCTCAGG - Intronic
912352145 1:109024337-109024359 CACCTCAGCCTCCAGAGTGCTGG - Intronic
913027620 1:114861879-114861901 AACCGCTGCCTCCTGGGTTCAGG + Intronic
913044387 1:115061745-115061767 CACTGCAGCCTCCCAACTCCTGG + Intronic
913370862 1:118097151-118097173 AACCTCCGCCTCCTGAGTTCAGG - Intronic
913439986 1:118887032-118887054 CACTGCTGCTTCCTGACTTTGGG - Intronic
913549464 1:119903234-119903256 CACTGGAGGCTCCACAGTTCTGG - Intergenic
913659959 1:120998047-120998069 CACTTCAGCCTCCCAAGTGCTGG - Intergenic
914723360 1:150307469-150307491 CACCTCAGCCTCCTGAGTAGAGG + Intronic
914762100 1:150607346-150607368 CACTGCAACCTCCTGCCTCCTGG + Intronic
914794415 1:150908082-150908104 CACTGCAGCCTCCCAGGCTCAGG + Intergenic
914836424 1:151210658-151210680 CACTGCAGCCTCCCGTCTCCTGG + Intronic
914864649 1:151416418-151416440 AACTTAAGCCTCCTGGGTTCAGG - Intronic
915084118 1:153373338-153373360 CGCCCCAGCCTCCTGAGTACTGG + Intergenic
915599618 1:156914002-156914024 CCAGGCAGCCTCCTCAGTTCTGG + Exonic
916059569 1:161089382-161089404 CTCTGCAGCTTCCTGCCTTCTGG - Exonic
916238231 1:162612137-162612159 CAAGGGAGCCTCCTGAGTGCTGG + Intergenic
916262728 1:162858629-162858651 CATTTCAGACTCCTGAGTTCTGG + Intronic
916317106 1:163461364-163461386 CACTGAAGCATCTTGAGTTAGGG + Intergenic
916728159 1:167542464-167542486 AAATGCAGACTCCTGAGTTTCGG + Intronic
916918967 1:169440857-169440879 CACTGTAGCCTCCTGCCTCCTGG - Intronic
917355295 1:174120950-174120972 AACTTCTGCCTCCTGGGTTCAGG + Intergenic
917502085 1:175594778-175594800 CACTGCAACCTCCTGCCTTCTGG - Intronic
917715095 1:177726931-177726953 CACCACAGCCTCCTGAGTGCTGG - Intergenic
917766147 1:178219525-178219547 CACCGCAGCCTCCTGAGTAGAGG - Intronic
917928140 1:179805959-179805981 GCCTGCAGCCTCTTCAGTTCAGG + Intronic
918127041 1:181593612-181593634 CACTGCAACCTCCTCCGCTCGGG + Intronic
918407717 1:184226895-184226917 CACCGCAGCCTCTTGACCTCCGG - Intergenic
918479268 1:184960702-184960724 CACTGCAGCCTCCACACTGCAGG + Intronic
919092655 1:192993213-192993235 AACTTCTGCCTCCTGAGTTCAGG - Intergenic
919856437 1:201709455-201709477 CTCTGCAGCCTCTGGAGCTCTGG + Intronic
919861032 1:201739702-201739724 CACCGAAGCCTCCTCCGTTCCGG - Intronic
919885696 1:201932626-201932648 CACCTCAGCCTCCTGACTACAGG - Intronic
920031620 1:203040882-203040904 CACTGAAGCTTCATGAGGTCAGG + Intronic
920868668 1:209774859-209774881 TACTGCTGCTTCCTTAGTTCAGG - Intronic
920943154 1:210503039-210503061 CACTGCAACCTCCTGGGTTCAGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921246134 1:213243069-213243091 CACTGCAGCCTCCCAACTCCTGG + Intronic
921922145 1:220682309-220682331 CACTGCAGCCTCCACCTTTCGGG + Intergenic
922239083 1:223743781-223743803 CAGTTCAGCCACCAGAGTTCTGG + Intronic
922244793 1:223785634-223785656 CACTTCAGCCTCCAAAGTGCTGG + Intronic
922486643 1:225978107-225978129 CACTGCAGCCTCCACCGCTCGGG - Intergenic
922602159 1:226864744-226864766 AACCTCCGCCTCCTGAGTTCAGG + Intergenic
922766975 1:228161116-228161138 CACCCCAGCCTCCTGAGTACTGG - Intergenic
923527538 1:234784264-234784286 GAATGCAGGCTCCTGACTTCTGG + Intergenic
923605199 1:235437045-235437067 AACCTCCGCCTCCTGAGTTCAGG - Intronic
923809586 1:237298278-237298300 AACTCCGCCCTCCTGAGTTCAGG - Intronic
923821806 1:237451497-237451519 AACCTCTGCCTCCTGAGTTCAGG - Intronic
924089836 1:240491032-240491054 GATTTCTGCCTCCTGAGTTCAGG + Exonic
924234557 1:241989809-241989831 CACTGCAGCCTTCTGCCTCCCGG - Intergenic
924543599 1:245004489-245004511 CACCTCAGCCTCCTGAGTAGCGG + Intronic
924580050 1:245315638-245315660 AACCTCCGCCTCCTGAGTTCAGG - Intronic
924773149 1:247094240-247094262 CACTGCAGCTTTCTGAATCCTGG + Intergenic
924881129 1:248164337-248164359 GACTGGAGCCCCCTGAGTACTGG - Intergenic
1063461525 10:6217611-6217633 CTCAGCAGCCTCCTGAGTTTGGG + Intronic
1063660210 10:8030318-8030340 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1063708328 10:8452700-8452722 CACTGCAGCCTCTGACGTTCTGG + Intergenic
1063766966 10:9153384-9153406 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1063925139 10:10970142-10970164 CACTGCAGCCTCCTTCTTGCAGG + Intergenic
1064067235 10:12192767-12192789 AACTGCTGCCTCCTAGGTTCAGG - Intronic
1064198718 10:13266495-13266517 TACCTCAGCCTCCTGAGTGCTGG + Intergenic
1064553887 10:16529095-16529117 CACTGCAGCCTCCAGCATCCAGG + Intergenic
1064668940 10:17688542-17688564 CACCTCTGCCTCCTGGGTTCAGG + Intronic
1064731028 10:18331065-18331087 AACTTCCGCCTCCTGGGTTCAGG + Intronic
1065129096 10:22602316-22602338 CACTGCAGCCTCCCAACTCCTGG - Intronic
1065292087 10:24240967-24240989 CACCTCAGCCTCCTGACTACTGG + Intronic
1065342212 10:24718092-24718114 CACTACCCCCACCTGAGTTCAGG - Intronic
1065960365 10:30729290-30729312 CACTTCAACCTCCCAAGTTCTGG + Intergenic
1066079061 10:31911426-31911448 CACTTCAGCCTCCCGAGTAGCGG + Intronic
1066372108 10:34825916-34825938 CATCTCAGCCTCCTGAGTACTGG - Intergenic
1066731710 10:38442469-38442491 CACCTCAGCCTCCCGAGTACCGG - Intergenic
1067001005 10:42613464-42613486 AACTTCTGCCTCCTGGGTTCAGG - Intronic
1067323930 10:45248471-45248493 CACCTCAGCCTCCTAAGTACTGG + Intergenic
1067512726 10:46909167-46909189 CACTGCAGTCTCCATACTTCAGG - Intergenic
1068040054 10:51812526-51812548 CACTGCAGCTTTCTGAATCCTGG - Intronic
1068693078 10:59938197-59938219 CATTGCAGCTTACTGAATTCCGG + Intergenic
1068721467 10:60250878-60250900 GACAGCAGCCTCTTGTGTTCTGG - Intronic
1069015685 10:63426587-63426609 AACTTCCGCCTCCTGGGTTCAGG - Intronic
1069232693 10:66031541-66031563 CACTGGAGCCTCCAAAGTTGGGG + Intronic
1069362210 10:67655565-67655587 CACTACAATCTCCTGAGGTCAGG + Intronic
1069662052 10:70130067-70130089 CACCTCAGCCTCCTGATATCAGG - Intronic
1069665762 10:70156595-70156617 CACTGTAACCTCCAGACTTCTGG - Intronic
1069923691 10:71833342-71833364 CACCTCAGCCTCCTGAGTACTGG - Intronic
1070175231 10:73964352-73964374 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1070291360 10:75117306-75117328 CACCTCAGCCTCCTGAGTTCTGG - Intronic
1070293158 10:75134945-75134967 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1070302518 10:75214604-75214626 AACCTCCGCCTCCTGAGTTCAGG + Intronic
1070779942 10:79131701-79131723 CTCTGCTGCCCCCTGAGTTGGGG + Intronic
1071128740 10:82367743-82367765 CACCTCAGCCTCCTAAGTTCTGG - Intronic
1071585305 10:86814865-86814887 AACCTCTGCCTCCTGAGTTCAGG + Intronic
1071861192 10:89674458-89674480 CACTGCAGCCTCCTATCTCCCGG + Intergenic
1072066718 10:91878513-91878535 CACCTCAGCCTTCTGAGTGCTGG - Intergenic
1072106839 10:92282570-92282592 TGCTTCAGCCTCCTGAGTTTGGG - Intronic
1072155118 10:92716894-92716916 CTCTGCTTCCTGCTGAGTTCTGG + Intergenic
1072593624 10:96850598-96850620 CACCTCAGCCTCCTGAGTATGGG + Intronic
1072667215 10:97402539-97402561 CACTGCAACCTCCACATTTCAGG + Intronic
1072703763 10:97664955-97664977 CACTGAAGCATCCTGACTCCTGG + Exonic
1072744427 10:97929825-97929847 CACAGTTGCCTCCTGAGTTGAGG - Intronic
1072828178 10:98629574-98629596 CACTGCCCCTCCCTGAGTTCTGG + Intronic
1073050894 10:100666575-100666597 AACGTCCGCCTCCTGAGTTCAGG - Intergenic
1073226579 10:101925827-101925849 AACCTCCGCCTCCTGAGTTCAGG - Intronic
1073438528 10:103537473-103537495 CACTGCAACCTCCTGGGCTCAGG + Intronic
1073551784 10:104408984-104409006 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1073849963 10:107603390-107603412 CACCTCAGCCTCTTGAGTGCTGG - Intergenic
1074039841 10:109777557-109777579 AACCTCCGCCTCCTGAGTTCAGG + Intergenic
1074113818 10:110440970-110440992 CATCCCAGCCTCCTGAGTACAGG - Intergenic
1074139368 10:110658570-110658592 CACTGCCGTCCCCTTAGTTCAGG + Intronic
1074179122 10:111042664-111042686 CACTTCTGCCTCCTGGGTTCAGG - Intergenic
1074183060 10:111079521-111079543 CTCTGCAGCCTCCTGCGGGCGGG + Exonic
1074294073 10:112166340-112166362 CACTGGAGCCTCCTGACTCCAGG + Intronic
1074750994 10:116586817-116586839 CACTGCAGCCTCCGCCTTTCGGG - Intergenic
1075364992 10:121878509-121878531 AACCTCTGCCTCCTGAGTTCAGG - Intronic
1075483894 10:122804871-122804893 TGCTGCCGCCTGCTGAGTTCCGG + Intergenic
1076291487 10:129349222-129349244 CGCAGCAGCCTTCTGAGCTCAGG + Intergenic
1076303712 10:129447990-129448012 AACCTCCGCCTCCTGAGTTCAGG - Intergenic
1076507287 10:130986621-130986643 CACTGAAGACTCCTGTGTACAGG - Intergenic
1077639248 11:3866506-3866528 AACTTCCGCCTCCTGGGTTCCGG + Intronic
1077663540 11:4089619-4089641 CTCTGCTGCCTGCTGAGTCCAGG + Intronic
1077667035 11:4120942-4120964 CACTGCAACCTCCTGCCTACCGG - Intronic
1078049989 11:7955748-7955770 CACTTTAGCCTCCAGAGTGCTGG + Intergenic
1078090069 11:8259560-8259582 CACTGCTGCCTGCTGAGGCCTGG - Intronic
1078248350 11:9596706-9596728 AACTGCCGCCTCCTGGGCTCAGG - Intergenic
1079221099 11:18561754-18561776 CACTGCAACCTCCTGCCTCCTGG - Intronic
1079440092 11:20504813-20504835 AACTGCCACCTCCTGGGTTCAGG + Intronic
1080008026 11:27429982-27430004 CACTGCACCCTGCTGAGGTGTGG - Intronic
1080039855 11:27748008-27748030 CACTGCAACCTCCTGCCTCCTGG - Intergenic
1080076995 11:28161202-28161224 CACTGCTGCCTCCCAGGTTCAGG + Intronic
1080548243 11:33343359-33343381 CACCTCCACCTCCTGAGTTCAGG + Intronic
1080591014 11:33723205-33723227 CACTGCCACCTCCTTATTTCAGG - Intronic
1080667363 11:34347358-34347380 CACTGCAGCCTCCTCCTTCCAGG - Intronic
1080735744 11:35012099-35012121 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1081840180 11:46194614-46194636 CACTGCAACCTCCTCTGTCCGGG - Intergenic
1081867184 11:46366425-46366447 CAGGGCTGCCTCCTGAGTTGCGG + Exonic
1081924294 11:46811556-46811578 AACCTCTGCCTCCTGAGTTCAGG + Intronic
1082047330 11:47740673-47740695 AACTTCCGCCTCCTGGGTTCAGG + Intronic
1083108358 11:60380621-60380643 GTCACCAGCCTCCTGAGTTCTGG - Intronic
1083340953 11:61958078-61958100 CCCTGGAGCATCCTGATTTCAGG + Intronic
1083559572 11:63662135-63662157 CACTGCAGCCTCCACCGTGCAGG - Intronic
1083724706 11:64622122-64622144 CACTGAAGCTGCCTGAGTTGTGG + Intronic
1083760635 11:64815036-64815058 CACTTCAGCCTCCGAAGTGCTGG + Intergenic
1084126324 11:67101460-67101482 CACCTCAGCCTCCTGAGTACTGG - Intergenic
1084882980 11:72185173-72185195 GAATGCAGCCTCCTGATTACAGG - Intergenic
1084974693 11:72790293-72790315 AACTCAAGCCTCCTGACTTCAGG - Intronic
1085125169 11:73996393-73996415 CACTGCAGCCTCCAGACTCCTGG - Intergenic
1085289382 11:75386811-75386833 CACTGCAACCTCCGGCTTTCAGG + Intergenic
1085550497 11:77365749-77365771 AACCTCTGCCTCCTGAGTTCAGG - Intronic
1085783256 11:79428635-79428657 CACAGCTGCCTTCTGAGTGCTGG - Intronic
1085950236 11:81321797-81321819 AACCTCAGCCTCCTGGGTTCAGG + Intergenic
1086103455 11:83125809-83125831 CACCTCAGCCTCCTGAGTATTGG + Intergenic
1087064786 11:94017925-94017947 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1087215802 11:95492505-95492527 CACTGCAACCTCCTGTACTCAGG + Intergenic
1087528042 11:99343060-99343082 CACTGCAGCATCCTCTATTCTGG - Intronic
1087766935 11:102165244-102165266 CACCTCAGCCTCCTGAGAACTGG - Intronic
1088116907 11:106322798-106322820 AACCTCTGCCTCCTGAGTTCAGG + Intergenic
1088274125 11:108066227-108066249 CGCCTCAGCCTCCTGAGTACTGG - Intronic
1089305608 11:117524485-117524507 CACTGGAGCCTCATGACCTCTGG + Intronic
1089598270 11:119596457-119596479 AACCTCTGCCTCCTGAGTTCAGG + Intergenic
1089758463 11:120705305-120705327 CACTACTGCCTCCTGGGTTCAGG + Intronic
1089774437 11:120826585-120826607 CCCATCAGCCTCCTGATTTCAGG - Intronic
1090273357 11:125403168-125403190 CTCTGGAGCCTACTGAGTTCTGG + Intronic
1090522918 11:127498170-127498192 AACCTCCGCCTCCTGAGTTCAGG + Intergenic
1091415779 12:282251-282273 CACTTCAGCCTCCTGACCACAGG + Exonic
1091496903 12:980681-980703 AACCGCCGCCTCCTGGGTTCAGG + Intronic
1092237652 12:6820112-6820134 CACTGCTGCCTCTTGAATGCAGG + Exonic
1092296230 12:7201019-7201041 CACCTCAGCTTCCTGAGTACAGG - Intronic
1092898656 12:13037947-13037969 CACTTCAGCCTCCTGAGTGCTGG - Intergenic
1093032907 12:14305198-14305220 CACTGCAGCCTCCACATCTCGGG - Intergenic
1093042820 12:14403863-14403885 AACAGCAGCATGCTGAGTTCAGG - Intronic
1093483775 12:19631155-19631177 TACCTCAGCCTCCTGAGTACAGG + Intronic
1093642241 12:21541190-21541212 CACTGCAGTCTCCACATTTCTGG - Intronic
1094070108 12:26403502-26403524 CCCTTCAGCCTCCTGAGTAGCGG - Intronic
1094554521 12:31485059-31485081 CACTACAGCTTCCTGAATCCTGG + Intronic
1094621751 12:32086688-32086710 CTCCTCAGCCTCCTGAGTGCTGG + Intergenic
1095289566 12:40462649-40462671 TGCTTCAGCCTCCTGAGTACAGG + Intronic
1095344456 12:41133272-41133294 CACTTCAGCCTCCCAAGTTGTGG - Intergenic
1095581832 12:43808694-43808716 CACATCAGCCTCCTGAGAGCTGG - Intergenic
1095998240 12:48107160-48107182 CTCAGCAGCTTGCTGAGTTCAGG + Intronic
1096026129 12:48363726-48363748 AACTTCTGCCTCCTGGGTTCAGG + Intergenic
1096169368 12:49454764-49454786 CACCTCAGCCTCCTGAGTCACGG - Intronic
1096297385 12:50395174-50395196 CACTGCAGTCTCCTGGGTTCAGG + Intronic
1096624501 12:52885662-52885684 AACTTCTGCCTCCTGAGTTCAGG - Intergenic
1096663852 12:53149002-53149024 AACTTCCGCCTCCTGGGTTCAGG - Intergenic
1097680184 12:62641718-62641740 CACCTCAGTCTCCTGAGTTGTGG + Intergenic
1097891898 12:64785225-64785247 CACTGCAGCCTCCTCCTCTCGGG + Intronic
1098149321 12:67530253-67530275 CAATGCAGCCTGGTGAGATCAGG + Intergenic
1098174535 12:67777241-67777263 CACTGCAGCCTCCGCTGCTCAGG - Intergenic
1098559722 12:71858627-71858649 CACTGCAGCCTCCCAGTTTCTGG + Intronic
1098936278 12:76483183-76483205 CACTGCAACCTCCTGTCTCCCGG - Intronic
1099089978 12:78294477-78294499 CACTGCACCCAGCTGATTTCAGG + Intergenic
1099853848 12:88139801-88139823 CACTGCAACCTCCTGCCTCCTGG + Intronic
1100488297 12:95053095-95053117 CACCTCAGCCTCCTGACTACGGG + Intronic
1100511710 12:95281362-95281384 TACTTCAGCCTCCTGAGTAGCGG - Intronic
1100520343 12:95368784-95368806 CACCTCAGCCTCCTGAGTGTAGG - Intergenic
1100531499 12:95465864-95465886 CACTTCAGCGTCCTGAGTACTGG - Intergenic
1100976811 12:100131195-100131217 CACTTCAGCCTCCTGAGTAGTGG - Intronic
1101095060 12:101329879-101329901 CACTTTAGCCTCCTGAGTACAGG - Intronic
1101462828 12:104913978-104914000 AACTTCTGCCTCCTGGGTTCAGG - Intronic
1101477571 12:105065063-105065085 AACTGCAGGCTCCTTAGATCAGG + Intronic
1101523373 12:105505397-105505419 TACTTCAACCTCCTGAGTACTGG + Intergenic
1101616720 12:106345074-106345096 CACTGAAGCCTCATGAGCTCAGG + Intronic
1101713097 12:107287060-107287082 AACCTCCGCCTCCTGAGTTCAGG + Intergenic
1101781694 12:107843948-107843970 CTCTGCAGCCACCAGAGATCTGG + Intergenic
1101926227 12:108973503-108973525 CACCTCAGCCTCCTGAGTAGGGG + Intronic
1102010457 12:109615341-109615363 CACTGCAGCCTCCCAACTTTGGG + Intergenic
1102117445 12:110413747-110413769 CACTTCCACCTCCTGGGTTCAGG - Intergenic
1102138353 12:110594001-110594023 CACCTCAGCCTCCTGAGTACAGG + Intergenic
1102233017 12:111276727-111276749 CACTGCAACCTCCTGGGTTCAGG + Intronic
1102338776 12:112105203-112105225 CACCTCAGCCTCCTGAGTACTGG - Intronic
1102393778 12:112570853-112570875 CACCTCCACCTCCTGAGTTCAGG + Intronic
1102397872 12:112602712-112602734 CACTGCAGCCTCGAAATTTCTGG - Intronic
1102477729 12:113199791-113199813 CACTGCAGCCTCCAAACTCCTGG + Intronic
1102499701 12:113343298-113343320 CACTGCAACCTCCTGGGTTCAGG - Intronic
1102632328 12:114291984-114292006 CACTGCAACCTCCTGAGCACAGG - Intergenic
1102843161 12:116147974-116147996 CACTGCAACCTCCTGCCTCCCGG - Intronic
1103297247 12:119898244-119898266 CACTGCGACTTCCTGAGCTCAGG + Intergenic
1103299301 12:119915753-119915775 CACTTCAGCCTCCCAAGTGCTGG + Intergenic
1103446671 12:120999451-120999473 CAGAGCAGCCTCCTGAGCCCGGG - Intronic
1103805257 12:123567572-123567594 CACTGCAACCTCCTGGGCTCAGG - Intergenic
1103889269 12:124226499-124226521 CACAGCAGCCTCGGGAGTTTAGG + Intronic
1103910081 12:124347290-124347312 CACTGCAGCCTCCGCCTTTCAGG - Intronic
1104032826 12:125077788-125077810 AACCTCTGCCTCCTGAGTTCAGG + Intronic
1105365481 13:19760444-19760466 AACCTCTGCCTCCTGAGTTCAGG - Intronic
1105370557 13:19798263-19798285 TACTGCAGCCTCCTGAGTACTGG - Intergenic
1105376223 13:19847716-19847738 CACTGCAACCTCCCGGGTTCAGG + Intronic
1105531068 13:21220904-21220926 CACCTCAGCCTCCTGAGTGATGG - Intergenic
1105802819 13:23924021-23924043 TACTTCAGCCTCCTGAGTTGTGG + Intergenic
1106035977 13:26045996-26046018 AACTTCAGCCTCCTGGATTCAGG - Exonic
1106079057 13:26485509-26485531 CTCTTCAGCCTGCTGATTTCTGG - Intergenic
1106267305 13:28122142-28122164 CACTGCAGCCTCTTGTTTCCTGG + Intergenic
1106592817 13:31111624-31111646 CACTGCATCCTCATGATTCCTGG - Intergenic
1106860132 13:33896628-33896650 AACCTCTGCCTCCTGAGTTCAGG - Intronic
1106901402 13:34357910-34357932 CAAGGGAGACTCCTGAGTTCAGG + Intergenic
1107010495 13:35665706-35665728 AACTTCCGCCTCCTGGGTTCAGG + Intronic
1107418005 13:40219316-40219338 CACTTCTGCCTCCTTACTTCGGG - Intergenic
1107690673 13:42949508-42949530 AACTGCTGCCTCCTGGGTTCAGG - Intronic
1107925340 13:45255082-45255104 AACTTCTGCCTCCTGGGTTCAGG - Intronic
1107932824 13:45320257-45320279 GACTGCTGCCTCCTGGGTGCTGG - Intergenic
1108189546 13:47923514-47923536 AACCTCCGCCTCCTGAGTTCAGG - Intergenic
1108287072 13:48919197-48919219 CCCTGCAGCCTCCTGAGTCTTGG - Intergenic
1108614283 13:52116065-52116087 CACCTCAGTCTCCTGAGTACTGG - Intronic
1108875543 13:55044375-55044397 AACCTCAGCCTCCTGGGTTCTGG - Intergenic
1109109969 13:58304162-58304184 CACTGCAACCTTCTGCCTTCTGG - Intergenic
1109259859 13:60131320-60131342 CACATCAGCCTCCTGAGTAGCGG - Intronic
1109516889 13:63455362-63455384 CACTGCTGCTTTCTGAGTTTAGG - Intergenic
1109751851 13:66703781-66703803 CACTTCAGCCTCCTGAGTAGTGG - Intronic
1109781065 13:67110430-67110452 AACCTCAGCCTCCTGGGTTCAGG - Intronic
1109970189 13:69757873-69757895 AACCTCTGCCTCCTGAGTTCAGG - Intronic
1110085407 13:71372998-71373020 CACTGCAGCCTTCTGCCTCCTGG + Intergenic
1110562215 13:76921528-76921550 CACTTCAGCCTCCTGAGAGCTGG + Intergenic
1110723194 13:78788745-78788767 AACTGCAGCCCCCTGTCTTCAGG - Intergenic
1110777431 13:79424783-79424805 CACCTCAGTCTCCTGAGTTGGGG + Intergenic
1111193320 13:84837743-84837765 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1112959090 13:105100580-105100602 AACATCAGCCTCCTGGGTTCAGG + Intergenic
1113213500 13:108011005-108011027 CACTGCAACCTCCTGCCTCCTGG + Intergenic
1113366107 13:109677394-109677416 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1113486349 13:110655208-110655230 CACTGCAGCCTGCAGAGTACAGG + Intronic
1113491435 13:110695166-110695188 CACTTCAGCCTCCAGAGTAGCGG - Intronic
1113816408 13:113174606-113174628 CACCTCAGCCTCCTGACTACAGG + Intergenic
1114195919 14:20476085-20476107 CACCTCAGCCTCCTGAGTAACGG + Intronic
1115428258 14:33286178-33286200 CACCCCAGCCTCCTGAGTCCAGG + Intronic
1115567578 14:34637978-34638000 CACCTCAGCCTCCTAAGTGCTGG - Intergenic
1115618071 14:35115274-35115296 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1115641426 14:35337856-35337878 TGCTGCTGCCTCCTGAGGTCAGG + Intergenic
1116291067 14:43041401-43041423 CACTGCAGCCTCCGCACTCCTGG + Intergenic
1116293835 14:43078513-43078535 CACGTCTGCCTCCTGGGTTCAGG - Intergenic
1116642194 14:47478487-47478509 CACCTCAGCCTCCTGAGAGCTGG + Intronic
1117130656 14:52683124-52683146 AACTTCCGCCTCCTGGGTTCAGG - Intronic
1117326622 14:54674860-54674882 CACCTCAGCCTCTTGAGTACTGG + Intronic
1118051584 14:62035238-62035260 AACTGCTGCATGCTGAGTTCTGG - Intronic
1118598878 14:67457528-67457550 CACTGCAGCCTCCAAACTCCTGG - Intronic
1118851086 14:69584052-69584074 CACTGCTGCTGCCTTAGTTCAGG - Intergenic
1118980779 14:70714665-70714687 AACTTCTGCCTCCTGGGTTCCGG - Intergenic
1119660123 14:76445095-76445117 CACTGCAGCCTCCAAACTCCTGG - Intronic
1119845879 14:77829406-77829428 CACTTTAGCCTCCTGAGTAGTGG + Intronic
1120248836 14:82037544-82037566 CATTACAACCTCCTGGGTTCTGG + Intergenic
1120798583 14:88664161-88664183 CAACTCAGCCTCCTGAGTGCTGG - Intronic
1120826821 14:88963526-88963548 CACTGCAGCCTCTAAAGTCCTGG - Intergenic
1120910943 14:89666174-89666196 CACCTCAGCCTCCTGAGTAGGGG + Intergenic
1120957146 14:90092796-90092818 CACTTCAGCCTCCTGAGTAGAGG - Intronic
1121058352 14:90879863-90879885 AACCCCTGCCTCCTGAGTTCAGG + Intronic
1121541964 14:94734896-94734918 AACCTCCGCCTCCTGAGTTCAGG + Intergenic
1121656632 14:95601753-95601775 CACTCCGGCCTCCTGGGTTGGGG + Intergenic
1121716358 14:96078795-96078817 CACAGCGGCCTCCTGAGCTGGGG - Intronic
1122090000 14:99331644-99331666 CACCTCGGCCTCCTGAGTGCTGG + Intergenic
1122120448 14:99550631-99550653 CACTGCAGTCTCCTAAGGTTGGG - Intronic
1122202379 14:100130464-100130486 CGCTGCAGCTTCCTCTGTTCTGG - Intronic
1122426977 14:101615943-101615965 CACCTCAGCTTCCTGAGTACTGG - Intergenic
1122432109 14:101658552-101658574 CACTTCAGTCTCCTGAGTACTGG - Intergenic
1122552834 14:102559296-102559318 CACTGCAGGGTCCTGAGGGCTGG + Intergenic
1123049459 14:105533719-105533741 CACTGCGGCCTCCTGGGTAATGG - Intergenic
1123068337 14:105629130-105629152 CTCTGCTGCCTCCTGAGCTCAGG + Intergenic
1123092356 14:105747454-105747476 CTCTGCTGCCTCCTGAGCTCAGG + Intergenic
1123097932 14:105775155-105775177 CTCTGCTGCCTCCTGAGCTCAGG + Intergenic
1123113630 14:105884095-105884117 CTCTGCAGCCTCCTGGGCTCTGG + Intergenic
1123115855 14:105893734-105893756 CTCTGCAGCCTCCTGGGCTCTGG + Intergenic
1123117880 14:105902844-105902866 CTCTGCAGCCTCCTGGGCTCTGG + Intergenic
1123120097 14:105912449-105912471 CTCTGCAGCCTCCTGGGCTCTGG + Intergenic
1123402835 15:20004035-20004057 CTCTGCAGCCTCCTGGGCTCTGG + Intergenic
1123512172 15:21010689-21010711 CTCTGCAGCCTCCTGGGCTCTGG + Intergenic
1123654793 15:22506470-22506492 CACTTCAGCCCCCTGAGTAGTGG + Intergenic
1123790122 15:23711549-23711571 CACTGCAGCCTCCACCTTTCAGG - Intergenic
1124456082 15:29844144-29844166 CACTGCAACCTCCTCATCTCGGG + Intronic
1125289358 15:38128808-38128830 CACTCCAGTCTCCTAGGTTCTGG + Intergenic
1125512384 15:40299033-40299055 CAGTGAAGCCTCCTGACTCCCGG + Intronic
1125560728 15:40631002-40631024 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1125580512 15:40782108-40782130 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1125781803 15:42275290-42275312 AACTGCCGCCTCCTGGGCTCAGG - Intronic
1125871344 15:43104950-43104972 CACTGCAACCTTCCGAGTTCAGG - Intronic
1126029632 15:44483454-44483476 AACCTCAACCTCCTGAGTTCAGG - Intronic
1126068508 15:44845349-44845371 AACCTCTGCCTCCTGAGTTCAGG + Intergenic
1126133230 15:45364457-45364479 CACTGCAGCCTCAAGACTCCTGG - Intronic
1126549640 15:49913015-49913037 CACTTCAGCGTCCTGAGTAGTGG - Intronic
1127119774 15:55761321-55761343 CACTGCAGCCTCCAAAGTGCTGG + Intergenic
1127441354 15:59012098-59012120 AACCTCCGCCTCCTGAGTTCAGG + Intronic
1127496573 15:59518397-59518419 CACTACAGCCTCCTGGGCTCAGG + Intronic
1127598066 15:60506909-60506931 CACTGCAACCTCCAGCTTTCAGG - Intronic
1127860894 15:62993623-62993645 TGCTGCAGCCTCCCGAGTACTGG - Intergenic
1127957640 15:63866889-63866911 CGCCTCAGCCTCCTGAGTACAGG + Intergenic
1127994342 15:64144394-64144416 CTCTGTAGCCTCCTGAGCTCTGG + Intronic
1128268985 15:66292644-66292666 CACTGCAGCCCCCGAACTTCTGG - Intergenic
1128330006 15:66749540-66749562 CACTGCAGCCTCCAACCTTCCGG - Intronic
1128397735 15:67245940-67245962 AACTCCAGCCTGCTGAGATCAGG - Intronic
1128517839 15:68354422-68354444 CACTGCAGATTCTTGAGTACAGG - Intronic
1128541828 15:68541157-68541179 CACTGCAGCCTCCACCTTTCAGG - Intergenic
1128751453 15:70153027-70153049 CACTGGAGCCTCTTGGCTTCAGG - Intergenic
1129617186 15:77107881-77107903 ACCTGCAGCCTTCTGAGGTCTGG + Exonic
1130653652 15:85776841-85776863 AACCTCCGCCTCCTGAGTTCAGG - Intronic
1130850129 15:87784682-87784704 CACCGCAGCCTGCTGAGCTGGGG + Intergenic
1131033851 15:89208088-89208110 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1131247205 15:90805387-90805409 AACTTCTGCCTCCTGGGTTCAGG - Intronic
1132506590 16:312936-312958 CACTTCAGCCTCACGAGTGCTGG - Intronic
1132506607 16:313061-313083 CACTTCAGCCTCATGAGTGCTGG - Intronic
1132607895 16:801053-801075 CTCTGCAGCCTGCAGGGTTCAGG + Intergenic
1132758698 16:1498549-1498571 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1132838507 16:1966827-1966849 AAATGCAGGCTCCTGAGCTCTGG + Intronic
1132847275 16:2006406-2006428 CACTGCCCGCTCCTGAGGTCTGG - Intronic
1132904292 16:2274190-2274212 CGCAGCAGCCTCCTGAGCTGCGG + Intergenic
1132949882 16:2555420-2555442 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1132964466 16:2644747-2644769 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1132965232 16:2650095-2650117 AACCTCCGCCTCCTGAGTTCAGG - Intergenic
1133057269 16:3151745-3151767 CACTGCAGCCTCCGGCCTCCCGG - Intergenic
1133128840 16:3663979-3664001 AACTTCCGCCTCCTGGGTTCAGG - Exonic
1133135969 16:3712205-3712227 AACTTCCGCCTCCTGAATTCAGG - Intronic
1133381983 16:5338768-5338790 CACTTTAGCCTCCTGAGTAGTGG + Intergenic
1133585164 16:7187082-7187104 CACTTTAGCCTCATGAGGTCAGG + Intronic
1133758006 16:8776978-8777000 AACCGCTGCCTCCTGGGTTCAGG + Intronic
1133770182 16:8863233-8863255 CACCCCAGCCTCCTGGGTTGTGG + Intronic
1133781805 16:8944854-8944876 CACTTCAGCCTCCCAAGTGCTGG - Intronic
1133820284 16:9229751-9229773 CACTGCAGCCTCCTCATCCCAGG - Intergenic
1134259103 16:12636586-12636608 CACTGCAGCCTCCAGCTTTGAGG + Intergenic
1134571389 16:15294165-15294187 CACTGCAACCTCCTGCCTTCCGG + Intergenic
1134730993 16:16461873-16461895 CACTGCAACCTCCTGCCTTCCGG - Intergenic
1134752328 16:16635896-16635918 CACTGCAGCCTCAACATTTCTGG + Intergenic
1134936437 16:18250019-18250041 CACTGCAACCTCCTGCCTTCCGG + Intergenic
1135036039 16:19077662-19077684 CACTGCAGCCTCCTCCTTCCAGG + Intronic
1135119274 16:19751362-19751384 CACCTCAGCCTCCCGAGTGCTGG - Intronic
1135404110 16:22185853-22185875 CACTTCAGCCTCCAGAGTAGTGG + Intronic
1135530350 16:23247688-23247710 CACCTCAGCCTCCCGAGTGCTGG - Intergenic
1135540825 16:23329185-23329207 CACTGCAGCCTCATCGGTTTGGG + Intronic
1135776988 16:25265465-25265487 CACTGCAGCCTCCACATCTCAGG + Intergenic
1135853764 16:25987850-25987872 AACTTCTGCCTCCTGGGTTCGGG + Intronic
1135974728 16:27100627-27100649 AACCTCCGCCTCCTGAGTTCAGG - Intergenic
1135989916 16:27211916-27211938 CACCTCAGCCTCCTAAGTGCTGG + Intronic
1136161359 16:28421239-28421261 CACCTCTGCCTCCTGAGTTCAGG - Intergenic
1136201605 16:28693752-28693774 CACCTCTGCCTCCTGAGTTCAGG + Intronic
1136217950 16:28807944-28807966 CACCTCTGCCTCCTGAGTTCAGG + Intergenic
1136231262 16:28886914-28886936 CACTGCAACCTCCCGGGTTCAGG - Intronic
1136271064 16:29148551-29148573 TGGTGCAGCCTCCTGACTTCAGG + Intergenic
1136589711 16:31210553-31210575 CACCTCAGCCTCCTGAGTAACGG - Intergenic
1136594314 16:31237170-31237192 CACCTCAGCCTCCTGAGTACTGG + Intergenic
1137299441 16:47133481-47133503 CACTGCAGCCTCTTAACTCCTGG - Intronic
1137560765 16:49500664-49500686 CACTTCAGCCTCCAAAGTGCTGG - Intronic
1137738915 16:50745667-50745689 CACTTCAGCCTCCAAAGTGCTGG + Intronic
1138147445 16:54625260-54625282 CACTGCAGCCTCCTTATTCCTGG + Intergenic
1138295826 16:55884421-55884443 AATTGCAGCCTCCTGCCTTCTGG + Intronic
1138316535 16:56074882-56074904 CACTGCAGCCTCCAATGTCCAGG - Intergenic
1138652485 16:58468643-58468665 CACTGCAACCTCCTAATCTCAGG - Intronic
1139042088 16:63010094-63010116 CACTTCAGCCTCCAAAGTGCTGG + Intergenic
1139074726 16:63430306-63430328 CACTACAGCTTTCTGAATTCCGG - Intergenic
1139163296 16:64536977-64536999 CACCTCTGCCTCCTGGGTTCAGG + Intergenic
1139593743 16:67946806-67946828 CACTGCTGCCACCTGAGAGCTGG - Intronic
1139602689 16:67996150-67996172 CACTTCAGCCTCCCGAGTCTGGG + Intronic
1139647669 16:68343318-68343340 CCCTGGAGCCTGCTGAGTCCCGG - Intronic
1139726246 16:68901568-68901590 AACCTCTGCCTCCTGAGTTCAGG + Intronic
1139747151 16:69083737-69083759 CCCTGCTGCCTCTTGAGTGCTGG + Exonic
1140049272 16:71465079-71465101 AACTTCCGCCTCCTGGGTTCAGG - Intronic
1140102198 16:71927405-71927427 CACCTCTGCCTCCTGGGTTCAGG - Intronic
1140224295 16:73066174-73066196 CCCTGCAGCCCGCTGAGCTCTGG - Intergenic
1140242551 16:73216679-73216701 AAGCTCAGCCTCCTGAGTTCAGG - Intergenic
1140485123 16:75287662-75287684 CACCTCAGCCTCTTGAGTGCTGG - Intergenic
1141250494 16:82352573-82352595 AACCTCTGCCTCCTGAGTTCAGG + Intergenic
1141295404 16:82763756-82763778 CACTGCAGCCTCCTCTGCCCAGG + Intronic
1141990895 16:87608921-87608943 CACCTCAGCCTCCTGAGTGGTGG - Intronic
1142074678 16:88110556-88110578 TGGTGCAGCCTCCTGACTTCAGG + Intronic
1142537835 17:632131-632153 CGCCGCAGCCTCCCGAGTACAGG - Intronic
1142754484 17:2007868-2007890 CACTGCAGCCTCCTCCTTCCAGG - Intronic
1142801747 17:2350662-2350684 CACTCCAGCCTCCAGCGTGCCGG + Intronic
1142975689 17:3642610-3642632 CACTGCAACCTCCTGCCTCCCGG - Intronic
1143027756 17:3951095-3951117 CACTGCAACCTCCTGCCTCCCGG - Intronic
1143237421 17:5414889-5414911 CACTGCAACCTCCTCAGCCCGGG - Intronic
1143569714 17:7748607-7748629 CACCTCAGCTTCCTGAGTACTGG + Intronic
1143786286 17:9258225-9258247 CACGGCAGACTCCTGAGCTGAGG + Intronic
1143835892 17:9692275-9692297 AACCTCTGCCTCCTGAGTTCAGG - Intronic
1144745917 17:17614387-17614409 CACTTCAGCCTCCCAAGTGCTGG + Intergenic
1145074102 17:19836821-19836843 AACTTCCGCCTCCTGGGTTCAGG - Intronic
1145290639 17:21542802-21542824 CCCTTCACCTTCCTGAGTTCAGG + Intronic
1145744117 17:27300962-27300984 AACTTCCGCCTCCTGGGTTCAGG + Intronic
1145763923 17:27444990-27445012 CACCTCAGCCTCCTGAGTAATGG + Intergenic
1145765080 17:27453407-27453429 CACTGCAGCCTCAAAAGTCCTGG - Intergenic
1145911766 17:28547262-28547284 AACTGGAGCCTCCTGGGGTCAGG + Exonic
1145919882 17:28602702-28602724 CGCCTCAGCCTCCTGAGTACTGG + Intronic
1146151256 17:30474650-30474672 CACTTCAGCCTCTTGAGTAGCGG + Intergenic
1146375557 17:32291597-32291619 AACCTCTGCCTCCTGAGTTCAGG - Intronic
1146509992 17:33438797-33438819 CACTTCAGCCTCTGGGGTTCTGG + Intronic
1146848465 17:36200975-36200997 CACTGCAGCATCCTGGGTTCAGG - Intronic
1147154163 17:38535048-38535070 CACTTCCACCTCCTGAGCTCAGG - Intronic
1147228315 17:38998376-38998398 CACTGCAACCTCCGCAGTCCCGG + Intergenic
1147342774 17:39764348-39764370 CACCTCAGCCTCTTGAGTACTGG - Intergenic
1147442618 17:40456624-40456646 CTCTGCAGCCTCCAGAGCACAGG - Exonic
1147790338 17:43010277-43010299 CATCTCAGCCTCCTGAGTACAGG - Intronic
1148006950 17:44440481-44440503 CACTGCAGCCTCCACCTTTCAGG + Intronic
1148099034 17:45075992-45076014 CACTGCAGCCTCCTCATCACAGG - Intronic
1148262523 17:46195635-46195657 CACTGCAGCCTCCCAGGCTCAGG + Intronic
1148421332 17:47549697-47549719 AACTTCCGCCTCCTGGGTTCAGG - Intronic
1148599577 17:48884025-48884047 CACCTCAGCCTCCTGAGGCCCGG + Intergenic
1149182599 17:53957039-53957061 CACTGCAGCCTCCAACTTTCTGG - Intergenic
1149329812 17:55569180-55569202 CACTGCAGCCTCCAAACTCCTGG + Intergenic
1149410264 17:56397778-56397800 CACAATAGCCTCCTGACTTCAGG - Intronic
1149628577 17:58099462-58099484 CACTGCAGCCTTCTAACTCCTGG + Intergenic
1149950743 17:60982380-60982402 CACTGCAGCCTCATAACTCCTGG + Intronic
1150106103 17:62463652-62463674 CACTGCAACCTCCCAGGTTCAGG - Intronic
1150131398 17:62671183-62671205 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1150153348 17:62829297-62829319 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1150270777 17:63863231-63863253 AACTGCAGCCTCCCGGGTTCAGG + Intergenic
1150274406 17:63886752-63886774 AACTGCAGCCTCCCGGGTTCAGG + Intergenic
1150276544 17:63901552-63901574 AACTTCAGCCTCCTGGGTTCAGG + Intergenic
1150332504 17:64305605-64305627 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1150422552 17:65051531-65051553 CACCTCCGCCTCCTGGGTTCAGG - Intronic
1150745803 17:67815631-67815653 AACTTCTGCCTCCTGGGTTCAGG + Intergenic
1150773271 17:68059676-68059698 CACTGTAACCTCCTGGGTTCAGG + Intergenic
1150800382 17:68277243-68277265 TACCTCAGCCTCCTGAGTGCTGG + Intronic
1150869518 17:68890592-68890614 CACTGCAACCTCCGCAGTCCAGG + Intronic
1150882321 17:69044115-69044137 CACTGCAGCCCCCAAACTTCTGG - Intronic
1150918455 17:69459634-69459656 CACTGCAGCCTCCGCCTTTCGGG - Intronic
1151191361 17:72400335-72400357 AACTGCAGCCTCCTGAGCAGAGG + Intergenic
1151579038 17:74967769-74967791 CACTGCAGCTTCCTGGGCTTAGG - Intronic
1151763996 17:76122699-76122721 CACTGCACCCTCCTCATTTGCGG - Intergenic
1151775367 17:76197680-76197702 CACCTCAGCCTCCCGAGTGCTGG + Intronic
1152030100 17:77837056-77837078 CACTGCAGCCTCCTGCTCCCAGG + Intergenic
1152411179 17:80124013-80124035 AGCTGCAGCCTGCTGAGCTCGGG - Intergenic
1152496840 17:80679159-80679181 AACTTCCGCCTCCCGAGTTCAGG - Intronic
1152588296 17:81198883-81198905 CACAGCAGCCTCCAGAGGACAGG - Exonic
1152591966 17:81218116-81218138 CACTGCAGCCTCCTCCGCCCGGG + Intronic
1152630529 17:81408832-81408854 GACTGCAGGCTCCTGAGTCTGGG + Intronic
1152660270 17:81538851-81538873 CACTGCAGCCTCCTGAACTAAGG - Intergenic
1152856109 17:82665326-82665348 CACTGCAGCCTCCACAGCCCAGG + Intronic
1153316214 18:3724793-3724815 CACCTCAGCCTCCTGAACTCAGG - Intronic
1153603400 18:6805732-6805754 CACCTCAGCCTCCTAAGTGCTGG + Intronic
1154149086 18:11891926-11891948 CACTTCAGCCTCCTGAGTAGCGG + Intronic
1154195922 18:12266840-12266862 AACTTCTGCCTCCCGAGTTCAGG + Intronic
1154259221 18:12815000-12815022 AACCGCCGCCTCCTGGGTTCAGG - Intronic
1155092771 18:22527440-22527462 CACCTCAGCCTCCTGAGTACTGG - Intergenic
1155456004 18:26013856-26013878 CACTGCAGCCTCCGCCGCTCAGG - Intergenic
1155467112 18:26148958-26148980 CACCTCAGCCTCCTGAATGCAGG + Intronic
1155566826 18:27144611-27144633 CACTGCAGCCTCCACCATTCTGG - Intronic
1155954737 18:31947371-31947393 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1155963716 18:32017331-32017353 CACTGCAGCCTCCACCTTTCCGG + Intergenic
1156324093 18:36057496-36057518 CACTTCAGCCCCCTGAGTACTGG - Intronic
1156754786 18:40509632-40509654 GACCTCTGCCTCCTGAGTTCAGG + Intergenic
1157035380 18:43966360-43966382 GACTTCCGCCTCCTGGGTTCGGG + Intergenic
1157767666 18:50313087-50313109 CACTGCAGCCTCTAAACTTCTGG + Intergenic
1157981845 18:52390701-52390723 AAATGCAGCATCCTGAGTCCTGG + Intronic
1158573279 18:58614670-58614692 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1158950141 18:62486776-62486798 CACTGCAGCCTCCTGGGCTTAGG - Intergenic
1159990070 18:74895814-74895836 TTCAGCAGCCTCCTGAGTTAGGG + Intronic
1161025825 19:2036460-2036482 AACCTCTGCCTCCTGAGTTCAGG - Intergenic
1161069369 19:2252698-2252720 CTCTGCAGCCTCCCGACTCCCGG + Exonic
1161118610 19:2512935-2512957 GACTGCAGCCTCCTGTGGTTGGG - Exonic
1161243985 19:3238814-3238836 TGCTTCAGCCTCCTGAGTACTGG - Intronic
1161295482 19:3517946-3517968 CACCTCAGCCTCCTGAGTCCTGG + Intronic
1161334508 19:3705356-3705378 AACCTCTGCCTCCTGAGTTCAGG - Intergenic
1161391078 19:4020706-4020728 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1161507898 19:4653865-4653887 CACTGCAGCCTCTTAACTCCTGG - Exonic
1161515998 19:4696983-4697005 CACCTCAGCCTCCTGAGTAGAGG - Intronic
1161660030 19:5540207-5540229 CACTGCAGCCTCCACCTTTCAGG - Intergenic
1161694137 19:5756165-5756187 CACGTCAGCCTCCTGAGTAGCGG - Intronic
1161919260 19:7253913-7253935 TACCTCAGCCTCCTGAGTGCTGG - Intronic
1161943530 19:7420200-7420222 TGCTGCAGCCTCCTAAGTACAGG + Intronic
1162034064 19:7929756-7929778 CACTGCAGCCACCTGAAATAGGG + Intronic
1162218916 19:9159620-9159642 CACTGCAGCCTCCACCTTTCAGG + Intronic
1162247835 19:9417288-9417310 AACTTCAGCCTCCCGGGTTCAGG - Intronic
1162759016 19:12877351-12877373 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1162768806 19:12937045-12937067 CACCTCAGCCTCCCGAGTACTGG + Intergenic
1162896458 19:13767449-13767471 CACCCCAGCCTCCTGATTACAGG - Intronic
1162928224 19:13941288-13941310 CACTGCAGCCTCCAGCTCTCAGG - Intronic
1162929428 19:13949773-13949795 CACTGTAGCCTCCAGGGCTCGGG + Intronic
1163095534 19:15054505-15054527 CACTGCAGCCTCTTAACTCCTGG - Intronic
1163177979 19:15577890-15577912 AACCTCTGCCTCCTGAGTTCAGG + Intergenic
1163344911 19:16734650-16734672 CACTGCAGCTTTCTGGGCTCAGG + Intronic
1163383050 19:16981245-16981267 CACTTCAGCCCCCTGAGTAGCGG - Intronic
1163540633 19:17907615-17907637 AACCTCTGCCTCCTGAGTTCAGG + Intergenic
1163706396 19:18816397-18816419 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1163757744 19:19116573-19116595 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1163811290 19:19433848-19433870 CACTGCAGCCTCCTGGGCTCAGG + Intronic
1164223981 19:23225490-23225512 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1164388435 19:27795625-27795647 CAATGGGGCCACCTGAGTTCTGG - Intergenic
1164582881 19:29445820-29445842 AACCTCTGCCTCCTGAGTTCAGG + Intergenic
1164611247 19:29633361-29633383 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1164970669 19:32529611-32529633 AACTTCAAACTCCTGAGTTCAGG - Intergenic
1164990397 19:32678348-32678370 CACTGCAGCCTCCAAATCTCGGG + Intergenic
1165196201 19:34105748-34105770 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1165241013 19:34467356-34467378 CACTTCAGCCTCCTGAGTAGCGG - Intronic
1165527143 19:36365844-36365866 CACCTCAGCCTCCTGAGTACTGG - Intronic
1165531425 19:36405100-36405122 AACCTCTGCCTCCTGAGTTCAGG - Intronic
1165534613 19:36433090-36433112 TGCTTCAGCCTCCTGAGTACTGG + Intergenic
1165585667 19:36913520-36913542 CACTGCCCCCTCCTGAGATGAGG + Intronic
1165708317 19:37991871-37991893 CACTGCAGGCAGCTGGGTTCGGG + Intronic
1165861115 19:38909984-38910006 CACCTCAGCCTCCTGAGAGCTGG + Intronic
1165910318 19:39222029-39222051 CACTGCAGCCTCCAAACTCCTGG + Intergenic
1166009610 19:39932809-39932831 CACCTCAGCCTCCCGAGTACTGG + Intronic
1166093658 19:40526284-40526306 TGCTTCAGCCTCCTGAGTACTGG + Intronic
1166296108 19:41890395-41890417 CACCTCAGCCTCCAAAGTTCTGG - Intronic
1166297455 19:41896069-41896091 GACTGCAGCCCCCTGAGGTCGGG - Intronic
1166392519 19:42417371-42417393 TACTTCAGCCTCCTGAGTAGTGG + Intronic
1166649324 19:44559603-44559625 CACTTCCGCCTCCTGGGTTCAGG - Intergenic
1167017986 19:46854077-46854099 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1167093827 19:47362844-47362866 CACTGCAGCCTCCATATTACAGG + Intronic
1167400292 19:49262489-49262511 CACTGCAGCCTCAAAACTTCTGG - Intergenic
1167653949 19:50751117-50751139 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1167685450 19:50953025-50953047 CACTGCCTCCTCCTGGGCTCTGG + Exonic
1167774539 19:51546023-51546045 CTCTGGAGCCTCCTGAGTGGGGG + Intergenic
1167835863 19:52069185-52069207 CACCTCAGCCTCCTGAGAGCTGG + Intronic
1167847349 19:52175383-52175405 CACCTCTGCCTCCTGGGTTCAGG - Intergenic
1167898228 19:52598832-52598854 CACTGCAGCCTCCAACTTTCTGG - Intronic
1168307025 19:55441359-55441381 CACTGCAGGGTCCTGAGCTCGGG - Intronic
1168365415 19:55782764-55782786 CACTGCACCCAGCTGAGTTGTGG - Intergenic
1168365662 19:55784724-55784746 CACTGCAGCCTTCTGCCTCCCGG - Intergenic
925035732 2:684122-684144 CACTGCAGCCTTCTGAGATGCGG + Intergenic
925233851 2:2259975-2259997 CACTGCAGCCTCCCCAGCCCAGG + Intronic
925379138 2:3412445-3412467 CGCCTCAGCCTCCTGAGTACTGG - Intronic
925881791 2:8358874-8358896 CACTTCAGCCTCCTGAGTAGTGG - Intergenic
926112670 2:10192943-10192965 CGCTGCAGTCTCCTGGGCTCAGG + Intronic
926122022 2:10246560-10246582 CACTGCAGCCTCCTCGTTCCGGG - Intergenic
926179258 2:10626103-10626125 CACTGCAGCCTCCAAACTCCTGG - Intronic
926191954 2:10734969-10734991 CACCACAGCCTCCTGAGTAGTGG - Intronic
926892395 2:17649674-17649696 CACGGCAGCCTCCTAGGTGCAGG + Intronic
926898940 2:17728319-17728341 CACCTCAGCCTCCTGAGAGCTGG - Intronic
927122606 2:19981629-19981651 CACCTCAGCCTCCTGAGTACTGG + Intronic
927552279 2:24010552-24010574 CACAGCAGCTGCCTGAGGTCGGG - Intronic
927665591 2:25030094-25030116 CACTGCAACCTCCGCAGCTCAGG - Intergenic
927972199 2:27312786-27312808 CACTGCAGCCTGCTGCTATCTGG - Intronic
928185022 2:29102443-29102465 TACTGTTGCCACCTGAGTTCAGG + Intronic
928295651 2:30080680-30080702 CACCTCAGCCTCCTGAGTAACGG - Intergenic
928378977 2:30802105-30802127 CTCTGCAGCCTCCACAGGTCAGG - Intronic
928510646 2:31999956-31999978 CACTGCAGCCTCCTGGACTCAGG + Intronic
929144926 2:38698288-38698310 CACTGCTGACTCCTAAGTGCCGG - Intronic
929194339 2:39169982-39170004 CACTTCAGCCTCCCAAGTACAGG + Intergenic
929205707 2:39290009-39290031 CACTGCAGCCTCCTCCTCTCGGG - Intronic
929214405 2:39396110-39396132 CACTGCAGCCTCTTAACTCCTGG + Intronic
929639453 2:43562324-43562346 AACCTCAGCCTCCTGGGTTCAGG + Intronic
929867491 2:45730539-45730561 GACTTCTGCCTCCTGGGTTCAGG + Intronic
929980881 2:46679120-46679142 CACTTCAGCCTCCCAAGTGCTGG - Intergenic
930134734 2:47890553-47890575 CACCTCGGCCTCCTGAGTGCTGG - Intronic
930197804 2:48527068-48527090 AACCTCCGCCTCCTGAGTTCAGG + Intergenic
930589815 2:53313816-53313838 AACCTCAGCCTCCTGGGTTCAGG - Intergenic
931327735 2:61244364-61244386 TACTGCAGCCTCCGAAGTGCTGG - Intronic
931478539 2:62616111-62616133 AACTTCCGCCTCCTGGGTTCAGG + Intergenic
931565253 2:63609283-63609305 CACTGCAACCTCCCAGGTTCAGG - Intronic
932201676 2:69833532-69833554 AACCTCCGCCTCCTGAGTTCAGG - Intronic
932250479 2:70238992-70239014 CACTGCAGCCTCTTAACTCCTGG - Intronic
932337829 2:70941029-70941051 CACCTCAGCCTCCTGAGAGCTGG + Exonic
932372293 2:71200674-71200696 CACTGCAACCTCCACAGTCCAGG - Intronic
933481111 2:82858337-82858359 CACTGCAGCCTCCTCTTTCCTGG + Intergenic
933675246 2:85050034-85050056 CACCTCAGCCTCCTGAGTAGCGG - Intronic
933827586 2:86177517-86177539 AACTTCTGCCTCCTGGGTTCTGG - Intronic
933912033 2:86949845-86949867 CACTGCTGCCTCCCGGGTTCAGG + Intronic
934010961 2:87820052-87820074 CACTGCTGCCTCCCGGGTTCAGG - Intronic
934058031 2:88268992-88269014 CACCTCAGCCTCCTGAGTATCGG + Intergenic
934610012 2:95728376-95728398 AACTTCTGCCTCCTGGGTTCAGG + Intergenic
934724904 2:96609867-96609889 AACCTCCGCCTCCTGAGTTCTGG - Intronic
934732275 2:96666899-96666921 CACTTCAGCCTCCCAAGTACTGG + Intergenic
935045650 2:99479672-99479694 CACCTCAGCCTCCTGACTACAGG - Intronic
935045841 2:99481791-99481813 CACTGTAGCCTCCAGCTTTCAGG - Intronic
935077759 2:99762236-99762258 CGCCTCAGCCTCCTGAGTCCTGG + Intronic
935117079 2:100145923-100145945 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
935140545 2:100349417-100349439 AACCTCTGCCTCCTGAGTTCAGG - Intergenic
935281248 2:101519743-101519765 CACCTCAGCCTCCTGACTACAGG - Intergenic
936025483 2:109028155-109028177 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
936271070 2:111049457-111049479 CACTGCTGCCTGCGGAGTGCGGG + Intronic
936603515 2:113924181-113924203 CACCTCAGCCTCCTGAGTAGCGG + Intronic
937108004 2:119337167-119337189 CACCTCAGCCTCCTGAGTGCTGG + Intronic
937456185 2:122043768-122043790 CACCTCAGCCTCCTAAGTGCTGG + Intergenic
937707659 2:124939930-124939952 CACTGCAGCTTTCTGAATCCAGG + Intergenic
938290912 2:130149977-130149999 CACTGCAGCCTCTTAACTCCTGG - Intergenic
938295563 2:130176799-130176821 CACGTCAGTCTCCTGAGTACAGG + Intronic
938302264 2:130225031-130225053 CGCCTCAGCCTCCTGAGTACAGG + Intergenic
938454416 2:131449237-131449259 CGCCTCAGCCTCCTGAGTACAGG - Intergenic
938461061 2:131497027-131497049 CACCTCAGTCTCCTGAGTACAGG - Intergenic
938465633 2:131522977-131522999 CACTGCAGCCTCTTAACTCCTGG + Intergenic
939954826 2:148519098-148519120 CACTGCAGCTTCCTGTGTCCTGG - Intergenic
939984245 2:148814350-148814372 CACTGCAGCCTCCAGTTTCCTGG - Intergenic
940141670 2:150498166-150498188 CACTGCAGCCTTCTGCCTTCCGG + Intronic
940342065 2:152591690-152591712 GGCTTCAGCCTCCTGAGTACCGG - Intronic
940518469 2:154712715-154712737 CACTTCGGCCTCCTGAGTATTGG - Intronic
940859574 2:158757915-158757937 CACTGCAACCTCCACATTTCAGG - Intergenic
941633819 2:167914025-167914047 CACCTCAGCTTCCTGAGTGCTGG - Intergenic
941770090 2:169335931-169335953 AACTTCTGCCTCCTGGGTTCAGG - Intronic
941823245 2:169864119-169864141 CACTGCAACCTTCTGCGTACAGG + Intronic
943287213 2:186017003-186017025 AACCTCTGCCTCCTGAGTTCAGG - Intergenic
943363676 2:186949398-186949420 AACCTCTGCCTCCTGAGTTCAGG - Intergenic
943754111 2:191540486-191540508 CACTTCAGCTTCCTGAGTGGTGG + Intergenic
944029485 2:195216938-195216960 CACCTCAGCCTTCTGAGTGCTGG + Intergenic
944113611 2:196162812-196162834 CACTGCAACCTCCTGTCTCCTGG - Intronic
944152460 2:196574346-196574368 AACCTCTGCCTCCTGAGTTCAGG - Intronic
944447383 2:199805207-199805229 CCCTGCAGCCTCCTCAGTCCAGG + Intronic
944596898 2:201269186-201269208 CACCTCAGCCTCCCAAGTTCTGG + Intronic
944713093 2:202353426-202353448 CACTGGAGCCTCCTGAGAGGGGG - Intergenic
944724691 2:202458392-202458414 CACTGCAACCTCCGGCTTTCAGG - Intronic
945470994 2:210227816-210227838 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
945621667 2:212147102-212147124 CACCTCAGCCTCCTGAGTAGTGG + Intronic
945932162 2:215866056-215866078 CACTTCAGCCTCCAAAGTGCTGG + Intergenic
946154293 2:217797022-217797044 CACTCCAGCCTCCTGGGTGACGG + Intergenic
946712980 2:222525413-222525435 CACTGGAGACCCCTGATTTCAGG - Intronic
947273114 2:228361603-228361625 AACCTCTGCCTCCTGAGTTCAGG + Intergenic
947310694 2:228798583-228798605 CAAAGCAGACTGCTGAGTTCAGG - Intergenic
947463607 2:230323361-230323383 CACTGCAGCCTCCTAAGGGCTGG - Intergenic
947512499 2:230769842-230769864 CACCTCAGCCTCCCGAGTCCCGG - Intronic
947669895 2:231929487-231929509 CACTCCACCCTCCCGAGGTCTGG - Intergenic
947775768 2:232708074-232708096 CACCTCAGCCTCCTGAGTATAGG + Intronic
948122341 2:235540230-235540252 AACCTCTGCCTCCTGAGTTCAGG + Intronic
948128644 2:235583790-235583812 AACCTCTGCCTCCTGAGTTCAGG - Intronic
948245984 2:236486287-236486309 GACTGCAGCCTTGTGAGATCTGG + Intronic
948307364 2:236959239-236959261 CACTTCAGCCTCCCGAGTATAGG + Intergenic
948810499 2:240473008-240473030 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
948890893 2:240906611-240906633 CCCTGCACCCTCCTGAGAGCAGG + Intergenic
1169052361 20:2591589-2591611 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1169068769 20:2709103-2709125 AACCTCTGCCTCCTGAGTTCAGG - Intronic
1169131923 20:3170373-3170395 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1169440274 20:5628160-5628182 CACTGCAGCCTCCTCTGCCCGGG + Intergenic
1170200505 20:13738425-13738447 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1170564934 20:17593965-17593987 CACCTCAGCTTCCTGAGTACTGG - Intronic
1170644519 20:18185448-18185470 CACCTCAGCCTCCCGAGTGCTGG + Intronic
1170882922 20:20313428-20313450 CACCGCAGCCTACTGAATTGCGG - Intronic
1170989712 20:21290882-21290904 CACTGCAGCCTCCCAGGTTCAGG - Intergenic
1171060796 20:21957237-21957259 CACTGCAGGCTGCTGACATCAGG - Intergenic
1171370561 20:24659481-24659503 TGCTGCAGCATCCTGAGTGCTGG + Intronic
1171376469 20:24697335-24697357 CACTGCAAGCTGCTGTGTTCTGG + Intergenic
1172003728 20:31802404-31802426 CACTGCAGCCTCCCGCCTCCTGG + Intergenic
1172403304 20:34668519-34668541 CACTTCAGCCTCCAAAGTGCTGG - Intronic
1172589748 20:36109233-36109255 CACTGCACCCGGCCGAGTTCAGG + Intronic
1172710352 20:36917567-36917589 AACCTCCGCCTCCTGAGTTCAGG - Intronic
1172734925 20:37119352-37119374 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1172815600 20:37683549-37683571 CACCTCAGCGTCCTGAGTACAGG + Intergenic
1173393372 20:42655199-42655221 CACTGCACCCAGCTGAGATCTGG - Intronic
1173494815 20:43510970-43510992 CACCTCAGCCTCCAGAGTACTGG + Intronic
1173627911 20:44487326-44487348 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1173963728 20:47094916-47094938 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1174046761 20:47739309-47739331 CACTGCAGCCTCCTGGGATCTGG + Intronic
1174186634 20:48710937-48710959 CACTGCGGCCTCATGTGATCTGG - Intronic
1174609608 20:51788400-51788422 CACTGCACCCAGCTGAGTCCAGG - Intronic
1176087067 20:63302394-63302416 CACTGAAGCCTCCTGCTTCCAGG + Intronic
1176613209 21:9005527-9005549 CAGTCCAGCCTCCTTAGTACAGG - Intergenic
1176952668 21:15064961-15064983 CGCCGCCGCCTCCCGAGTTCGGG + Exonic
1177615038 21:23505882-23505904 GACTGTAGCCTACTGAGTTTAGG + Intergenic
1177923444 21:27183713-27183735 CACTGCAACCTCCTCTTTTCAGG - Intergenic
1178251782 21:31010213-31010235 CACTTCAGCCTCCTGAGTAGCGG - Intergenic
1178300290 21:31447320-31447342 CACCTCAGCCTCCTGAGAGCTGG - Intronic
1178452457 21:32715390-32715412 AACCTCAGCCTCCTGGGTTCAGG - Intronic
1178808088 21:35856257-35856279 CACTCAAGTCTTCTGAGTTCTGG - Intronic
1178945487 21:36943703-36943725 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1179216245 21:39369464-39369486 CACTGCAGCCTCCCAAGTACTGG + Intergenic
1180288005 22:10769080-10769102 CACTTCCGTCTCCTGGGTTCAGG - Intergenic
1180630539 22:17226455-17226477 CACTGCAACCTCCTGCCTCCCGG - Intergenic
1180722373 22:17919144-17919166 CAGTGCAGCTTCCTCAGCTCAGG + Intronic
1180996022 22:19965746-19965768 CAGTGCCTCCTCGTGAGTTCAGG - Intronic
1181105230 22:20570471-20570493 AACTTCTGCCTCCTGGGTTCAGG + Intronic
1181227181 22:21399515-21399537 CCCCTCAGCCTCCTGAGTGCTGG - Intergenic
1181259004 22:21583948-21583970 CACTGCAACCTCCTGCCTCCTGG + Intronic
1181609831 22:24004918-24004940 CACCTCAGCCTCCAGAGTGCTGG - Intergenic
1181704274 22:24639415-24639437 AACTTCTGCCTCCTGGGTTCAGG + Intergenic
1181874800 22:25931756-25931778 CACTGCAGCCTCAACATTTCAGG + Intronic
1182108266 22:27704589-27704611 CACAGCAGCCTCCTGAGCTGGGG + Intergenic
1182136524 22:27909313-27909335 CACCTCAGCCTCCCAAGTTCTGG + Intronic
1182509986 22:30812239-30812261 CACTGCAACCTCCTGCTTCCAGG + Intronic
1182602311 22:31475759-31475781 CACCGCAGCCTCCTGAGTAGCGG - Intronic
1182629671 22:31675496-31675518 CACTGCAGCCTCCGCCTTTCCGG - Intergenic
1183246390 22:36696907-36696929 CACTGCAGCCTTGTGTGATCTGG - Intronic
1183280452 22:36929399-36929421 CAGTCCAGCCTCCTGAGCCCAGG + Exonic
1183319421 22:37156017-37156039 GACTGCATCCTCCTCAGTCCTGG + Intronic
1183672610 22:39282050-39282072 CACCCCAGCTTCCTGAGTGCTGG + Intergenic
1184008548 22:41729217-41729239 CATTTCAGCCTCCTGAGTAGCGG - Intronic
1184089954 22:42287562-42287584 CACTGCTGACTCCTCAGTGCCGG - Intronic
1184270964 22:43383173-43383195 CACTGCAGCCTCCCAACTCCTGG - Intergenic
1184413673 22:44339952-44339974 CACAGCAGCCTCTGGAGTCCAGG - Intergenic
1184579717 22:45407573-45407595 CACCTCAGCCTCCTAAGTACTGG + Intronic
1184606625 22:45578127-45578149 CACTGCACGCTCGTGGGTTCTGG - Intronic
1184648475 22:45908724-45908746 CTCTGGAGCCTCCTGGGTACTGG - Intergenic
1184977298 22:48071461-48071483 CACTGCAGGCACCTGCTTTCAGG - Intergenic
1185272223 22:49934860-49934882 CCCTGCAGCCTCCTCAGGCCAGG - Intergenic
949101524 3:151386-151408 CACTTCGCCCTCCTGAGCTCAGG - Intergenic
949288325 3:2432882-2432904 CACTGCAGCATCCACAGCTCAGG + Intronic
949352932 3:3143780-3143802 CACTGCAGCCTCCCAGGTTCAGG - Intronic
950138081 3:10596838-10596860 CCCTGCAGCCTCCTTCGTTTGGG - Intronic
950410725 3:12834848-12834870 AACTTCTGCCTCCTGGGTTCAGG - Exonic
951378706 3:21956070-21956092 CACCTCAGCCTCTTGAGTACTGG - Intronic
951932731 3:27986697-27986719 CACTGCAGCCTGTTCAGTTTGGG - Intergenic
952304214 3:32130931-32130953 AACTTCCGCCTCCTGGGTTCAGG - Intronic
952313705 3:32213766-32213788 CACTGTAGTCTCCTGGGCTCAGG + Intergenic
952456863 3:33480949-33480971 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
952804676 3:37337279-37337301 AACCTCTGCCTCCTGAGTTCAGG + Intronic
953014885 3:39064347-39064369 CACTGCAACCTCTTGACTCCTGG + Intronic
953034004 3:39196081-39196103 CACTGCAGCCTCCACCTTTCTGG - Intergenic
953898103 3:46819413-46819435 CACCTCAGCCTCCTGAGTACCGG - Intergenic
953946908 3:47157147-47157169 CACTTCAGCCTTCTGAGTAGCGG - Intronic
954023939 3:47767099-47767121 AACTTCCGCCTCCTGGGTTCAGG - Intronic
955131851 3:56177703-56177725 GACTGCAGGCTCCTGACTTTTGG - Intronic
955151607 3:56372612-56372634 CACCTCAGCCTCCTGAGTAGCGG - Intronic
955397184 3:58565899-58565921 CGCTGCAGACTTCTGAGTGCAGG + Exonic
955835331 3:63048236-63048258 CACCTCAGCCTCCTGAGTGCTGG - Intergenic
956118251 3:65940352-65940374 GACTTCAGCCTCCAGAGCTCTGG - Intronic
956217172 3:66860614-66860636 CACTTCAGCCTCCTGAGTAGCGG + Intergenic
956453436 3:69396427-69396449 CACTGCAGCCTCCTGCTCTTGGG - Intronic
956586274 3:70868411-70868433 CATTGCATCCTCCTGAGTGGAGG - Intergenic
956862748 3:73340572-73340594 AACCTCTGCCTCCTGAGTTCAGG + Intergenic
958540151 3:95460872-95460894 CAATGCAGTCTCCTGGGCTCAGG + Intergenic
958948330 3:100389956-100389978 AACCTCCGCCTCCTGAGTTCAGG - Intronic
959171552 3:102849735-102849757 CACTTCAGCCTCCAGAGTAGCGG + Intergenic
959302063 3:104615446-104615468 CACTTCAGCCTCCTGATAGCTGG + Intergenic
960037111 3:113112916-113112938 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
960098340 3:113710041-113710063 CACTGCAAACTCCTGGGCTCAGG + Intergenic
960138560 3:114129997-114130019 CATCTCAGCCTCCTGAGTTCTGG - Intronic
960656580 3:120010991-120011013 CACTGCAGCCTCCCGCCTCCTGG - Intronic
960732268 3:120740373-120740395 CACCTCAGCCTCCTGAGTAGCGG + Intronic
960891533 3:122453191-122453213 CACTTCAGCCTCCCAAGTGCTGG + Intronic
961184124 3:124899738-124899760 CACTTCAGCCTCCTGAGTGGTGG - Intronic
961256591 3:125559707-125559729 CACCTCAGCCTCCTGAGTTGGGG + Intronic
961304249 3:125945293-125945315 CACCTCAGCCTCTTGAGTGCTGG + Intergenic
961648706 3:128406697-128406719 CACCTCAGCCTCCTGAGTAGTGG - Intronic
962069666 3:132020277-132020299 CACTCCAGCCTTCAGAGTGCTGG - Intronic
962771837 3:138618584-138618606 AACTTCTGCCTCCTGGGTTCAGG - Intronic
963131519 3:141862669-141862691 CACTTCAGTCTCTTGAGTCCAGG - Intergenic
963424787 3:145112341-145112363 CACTGTAGCATCCTGAGGACAGG + Intergenic
963804418 3:149709087-149709109 CACCCCAGCCTCCTGAGTACTGG + Intronic
964346934 3:155763085-155763107 CACTGCAACCTCCTGCTTCCTGG - Exonic
965379765 3:167973961-167973983 CACTGCAGCTTCCCTGGTTCAGG + Intergenic
965575604 3:170214724-170214746 CACCACAGCCTCCTGAGTAGTGG - Intergenic
965801836 3:172502474-172502496 CACCTCAGCCTCCTGAGTCATGG + Intergenic
965918433 3:173881178-173881200 AACTGCCGCCTCCTGGGTTCAGG + Intronic
967019594 3:185511144-185511166 CACCTCAGCCTCCTGAGTAGTGG + Intronic
967811731 3:193766365-193766387 GCCAGCAGCCTTCTGAGTTCTGG - Intergenic
967952304 3:194850819-194850841 AACTTCTGCCTCCTGGGTTCAGG + Intergenic
968191675 3:196672788-196672810 CACCTCAGCCTCCTGGGTACTGG + Intronic
968200763 3:196753058-196753080 AACTTCCGCCTCCCGAGTTCAGG + Intronic
968311720 3:197689137-197689159 CACCTCAGCCTCCAGAGTGCTGG + Intronic
969721854 4:8896411-8896433 CCCACCAGCCTCCTGAGGTCAGG - Intergenic
970163262 4:13210327-13210349 GGCTTCAGCCTCCTGGGTTCCGG + Intergenic
970692987 4:18641510-18641532 GACTGCAGCCTCCTGGGGTGGGG + Intergenic
970849761 4:20587265-20587287 CTCCTCAGCCTCCTAAGTTCGGG + Intronic
971349762 4:25845380-25845402 CACCTCAGCCTCCTGAGTAGCGG - Intronic
971521366 4:27556117-27556139 CACACCTGCCTCCTGGGTTCTGG + Intergenic
971589377 4:28447467-28447489 GAATGCAGCCTCCTGAGATACGG - Intergenic
971762872 4:30790807-30790829 CACCTCAGCCTCCTGAGAGCTGG - Intronic
972551142 4:40135642-40135664 AACCTCTGCCTCCTGAGTTCAGG + Intronic
972636010 4:40884686-40884708 CACTGCAGCCTCCAAATTCCTGG - Intronic
972665659 4:41162739-41162761 CACCTCAGCCTCCTGAGTGCTGG - Intronic
972751386 4:41992225-41992247 CACCTCAGCCTCCTGAGTACAGG - Intronic
973307589 4:48670355-48670377 CACTGCAGCCTCCTCCTCTCGGG - Intronic
973934507 4:55829426-55829448 CAATGCAGCTTAATGAGTTCTGG - Intergenic
974634109 4:64536800-64536822 CACTTCAGCCTCCACAGTGCTGG + Intergenic
974942333 4:68484418-68484440 CACTTCAGTCTCCTGAGTAGCGG + Intronic
975536682 4:75458825-75458847 CACCTCAGCCTCCTGAATACTGG + Intergenic
975610237 4:76195995-76196017 AACTGCAGTCTCCTGAGAACAGG + Intronic
975777167 4:77799620-77799642 AACCTCTGCCTCCTGAGTTCAGG - Intronic
976302225 4:83526070-83526092 CACCCCAGCCTCCTGAGTAGTGG + Intergenic
976902148 4:90191595-90191617 CCCTGCAGCATCTTGAGTTCTGG + Intronic
976920547 4:90436942-90436964 GACTACAGCCTCCCGAGTGCTGG + Intronic
977101074 4:92815837-92815859 CACTGCAGCCTCCTGGACTCAGG - Intronic
977570201 4:98621265-98621287 AGCTGCAGCCTCCAGAGTTGTGG + Intronic
977582110 4:98736446-98736468 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
977783093 4:101002037-101002059 CACTGCAGCCTCCTGCCTCTAGG + Intergenic
978600251 4:110419671-110419693 CACTGCAGCCTCCAACTTTCTGG - Intronic
978835101 4:113139809-113139831 CACTGCTGCCTCTTGACTTCTGG - Intronic
978936043 4:114377318-114377340 AACTTCCGCCTCCTGAGTTCAGG + Intergenic
979324927 4:119368096-119368118 CTCTGCCTCCTCCTGGGTTCAGG + Intergenic
979491839 4:121337202-121337224 CACTGCAGGCTCCTCAGTAGAGG - Intronic
979786501 4:124721744-124721766 CACCTCAGCCTCCTGAGAGCTGG + Intergenic
980092597 4:128458028-128458050 CACTTCAGACTCCTGGGCTCTGG + Intergenic
980313659 4:131167343-131167365 AACTTCTGCCTCCTGGGTTCAGG - Intergenic
980956803 4:139437035-139437057 CACTGCAGCCTCCAGTGCTTTGG + Intergenic
981352451 4:143748264-143748286 CACTGCAACCTCCTGCCTTCTGG + Intergenic
981705960 4:147659323-147659345 CACTGCAGCCTCCACTTTTCGGG - Intronic
981728402 4:147871986-147872008 CACCTCAGCCTCCCGAGTACAGG - Intronic
982061472 4:151608486-151608508 CATTGCAAACTCCTGGGTTCCGG + Intronic
982116948 4:152105766-152105788 CACTTCAGCCTCCTGAGTAGCGG - Intergenic
982208161 4:153012871-153012893 ACCTGCAGCCTCCAGATTTCTGG - Intergenic
982425821 4:155258236-155258258 CACTGCAACTTCCTGGGTTCAGG - Intergenic
982468469 4:155759373-155759395 CACCGCAGCTTCCTGAGCTCGGG + Intronic
982471654 4:155798911-155798933 CACTGCAGCCTCCTGCTCCCGGG + Intronic
982737671 4:159022952-159022974 CACTGCAACCTCCGAATTTCTGG - Intronic
982873824 4:160619110-160619132 CACTGTAACCTCCTGAGTAGCGG - Intergenic
983242833 4:165253114-165253136 CTCTGCCTCCTCCTGGGTTCAGG + Intronic
983632039 4:169859521-169859543 CACCTCGGCCTCCTGAGTGCCGG + Intergenic
983764312 4:171458262-171458284 TACCTCAGCCTCCTGAGTACTGG - Intergenic
983880805 4:172930194-172930216 AACTTCTGCCTCCTGTGTTCAGG - Intronic
984277185 4:177625346-177625368 CACTGCAGCCTCCACCTTTCAGG + Intergenic
984612673 4:181858198-181858220 CACCTCAGCCTCCTGAATTTTGG + Intergenic
984678395 4:182577583-182577605 CACTGCAGTCTCCTGTGTAACGG - Intronic
984972388 4:185203123-185203145 CACTGCAGCCTCCCAACTCCTGG - Intronic
984989781 4:185368867-185368889 CACTGCAGCCTCCTCCTTGCAGG + Intronic
985968239 5:3353808-3353830 CACTGCAGCCTCTGCAGCTCAGG - Intergenic
986320002 5:6622763-6622785 AACCTCCGCCTCCTGAGTTCAGG - Intronic
986328915 5:6703118-6703140 CACTGCAGCCTCCTGAGCCTGGG + Intergenic
986506370 5:8456489-8456511 CACTACAGCCACCATAGTTCAGG - Intergenic
986746058 5:10746409-10746431 AACCTCCGCCTCCTGAGTTCAGG + Intronic
987628234 5:20431416-20431438 CACTGCAGCCTCCACCTTTCTGG - Intronic
987714632 5:21551655-21551677 GACTGCAGACTTCTGAGTTCTGG - Intergenic
988599310 5:32624885-32624907 CTCTGTAACCTCCTGAGGTCAGG + Intergenic
988793923 5:34634654-34634676 CACTGCAACCTCCGCATTTCGGG - Intergenic
988808640 5:34763924-34763946 CACTGCAACCTCCTGCTTCCTGG + Intronic
988842303 5:35094939-35094961 CACCTCAGCCTCCTGAGTAGTGG + Intronic
989294470 5:39807627-39807649 CATTGCTGCCTCCTGGATTCTGG - Intergenic
990232154 5:53724947-53724969 CACTACAGCTTTCTGAATTCTGG + Intergenic
990242978 5:53834252-53834274 CACTGCAGCCCTATGAGTTAGGG - Intergenic
990316167 5:54585176-54585198 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
991607613 5:68419360-68419382 CACCTCAGCCTCCTAAGTACAGG + Intergenic
992042838 5:72853325-72853347 CACCTCAGCCTCCTGAGTAGCGG - Intronic
992121571 5:73598966-73598988 AACTTCTGCCTCCTGGGTTCAGG + Intergenic
992365174 5:76083450-76083472 CACTGCAGCCGCCTCAGTGCGGG - Exonic
992617453 5:78558588-78558610 CACCTCAGCCTCCTGAATACTGG + Intronic
992714549 5:79496982-79497004 CACTGAAGCCTCCTGGGTTCAGG - Intronic
992732315 5:79684368-79684390 CACCTCAGCCTCCTGAGTGCTGG + Intronic
992806711 5:80344992-80345014 CACTTCAGCCTCCCAAGTTGTGG - Intergenic
993157507 5:84244390-84244412 CATTTCAGCCTCCTGAGTAGCGG + Intronic
993996021 5:94724357-94724379 CACTTCAGCCTCTTGAGTAGCGG + Intronic
995222641 5:109668267-109668289 CACTGCAGCCTCAAGAGTCATGG + Intergenic
996148485 5:120005522-120005544 GACTGCAACCTCCTGTTTTCAGG - Intergenic
997164726 5:131647722-131647744 CACCTCAGCCTCCAAAGTTCTGG + Intronic
997334765 5:133099209-133099231 AACCTCCGCCTCCTGAGTTCAGG + Intronic
997511317 5:134456524-134456546 CACTGCAGCCTCCAGCTTCCAGG - Intergenic
997708420 5:135981212-135981234 CACCTCAGCCTCCTGAGTGCTGG + Intergenic
997892889 5:137690674-137690696 CTCTGCAGGCTCCTGGGGTCAGG + Intronic
998076080 5:139237508-139237530 CACCTCAGCCTCCTGAGTAGCGG + Intronic
998105398 5:139465733-139465755 CATTCCAGCCTCCTGAGTGCTGG - Intergenic
998179363 5:139925748-139925770 CAGCGCAGGCTCCTGAGGTCTGG + Intronic
998267265 5:140675505-140675527 CACCTCAGCCTCCTGACTACAGG + Intronic
998613842 5:143718490-143718512 CACTGCAGCCTCCATCTTTCAGG + Intergenic
998623042 5:143815601-143815623 CACTGCAACCTCCACATTTCGGG + Intronic
998865764 5:146499950-146499972 GACTTTAGCCTCCCGAGTTCCGG + Intronic
998865891 5:146501974-146501996 CACCTCTGCCTCCTGGGTTCAGG + Intronic
998968979 5:147570700-147570722 CACTGCAGCCTCCTGAGTAGCGG - Intergenic
999256621 5:150213211-150213233 CACACCAGCCTCCCAAGTTCAGG - Intronic
999387881 5:151168167-151168189 CACTTCAGCTTCCTGAGTATTGG - Intergenic
999580720 5:153035593-153035615 CACTGCAACCTCCTGCCTTTTGG - Intergenic
999999827 5:157127140-157127162 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1000091942 5:157937291-157937313 CACTGCAGCCTCTCAGGTTCAGG - Intergenic
1000153396 5:158526274-158526296 CAGTACAGAGTCCTGAGTTCTGG - Intergenic
1000308094 5:160014587-160014609 CACCTCAGCCTCCTGAGTGGTGG - Intronic
1000886572 5:166754315-166754337 AACTTCAGCCTCCCGAGTTCAGG - Intergenic
1000921399 5:167142624-167142646 CACTGCAGCCTCCTCCACTCGGG + Intergenic
1001285364 5:170419201-170419223 CTCTGCAGCCTCCTAAGGACTGG - Intronic
1001385228 5:171333184-171333206 AACCTCCGCCTCCTGAGTTCAGG + Intergenic
1001410825 5:171510142-171510164 CACTGCAGTCTCCCGGGTTCAGG + Intergenic
1001421082 5:171587704-171587726 CACTTCAGCCTCCTGTGTAGTGG - Intergenic
1001636342 5:173213161-173213183 GACTCCAGCCACCTGAGTTATGG + Intergenic
1002127897 5:177060437-177060459 CACCTCCGCCTCCTGGGTTCAGG - Intronic
1002558518 5:180063264-180063286 CACGGCTGCCGCCTTAGTTCAGG - Intronic
1002705814 5:181160423-181160445 CCCTGCATCCTTCTGAGCTCAGG - Intergenic
1003208895 6:4041437-4041459 CACCTCAGCCTCCTGACTACAGG - Intronic
1003517452 6:6828606-6828628 AACTTCTGCCTCCTGGGTTCAGG - Intergenic
1003656381 6:8014353-8014375 AACCTCCGCCTCCTGAGTTCAGG + Exonic
1003670354 6:8151655-8151677 CACTGCAGCCTCCGCATTTTGGG + Intergenic
1004290451 6:14362362-14362384 CCCTGCACCCTCCTCAGTCCTGG + Intergenic
1004957682 6:20748238-20748260 CACTTCAGCCTCTTGAGTTGCGG - Intronic
1004967780 6:20874383-20874405 AACTTCCGCCTCCTGGGTTCAGG + Intronic
1004976675 6:20974863-20974885 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1005214818 6:23513038-23513060 CAACTCAGCCTCCTGAGTGCTGG - Intergenic
1005768247 6:29036649-29036671 CACTACAGCCTCCCGAGTAGCGG + Intergenic
1006124874 6:31831094-31831116 CACCTTAGCCTCCTGAGTACTGG + Intergenic
1006488685 6:34366972-34366994 AACCTCTGCCTCCTGAGTTCAGG + Intronic
1006649492 6:35539087-35539109 CACCTCAGCCTCTTGAGTACTGG + Intergenic
1006839200 6:37017600-37017622 CTCTGCTGGCTCCTGAGTCCTGG + Intronic
1006900349 6:37496356-37496378 CACTGCAGCCTCCAGCCTCCCGG - Intronic
1006930563 6:37685579-37685601 AAAAGCAGCCTCCTGATTTCTGG - Intronic
1006972708 6:38063054-38063076 CACTGCAGCCTTGTGAGACCTGG + Intronic
1006987974 6:38189409-38189431 TACTGCAGCATACTGGGTTCTGG - Intronic
1007054459 6:38868744-38868766 CACTGCAACCTCCTCATTCCAGG + Intronic
1007361814 6:41362729-41362751 CACCTCAGCCTTCTGAGTACTGG - Intergenic
1007470857 6:42089339-42089361 AACTTCTGCCTCCTGGGTTCAGG - Intergenic
1007773002 6:44206311-44206333 AACTGCCGCCTCCTGGGTTCAGG + Intergenic
1008757236 6:54810835-54810857 CACTGCAGCCTCCTCCCCTCGGG + Intergenic
1009002089 6:57730389-57730411 GACTGCAGACTTCTGAGTTCTGG + Intergenic
1009658223 6:66573349-66573371 TACCTTAGCCTCCTGAGTTCTGG - Intergenic
1009692219 6:67049822-67049844 CACTTCAGCCTCCAAAGTGCTGG + Intergenic
1009902260 6:69821648-69821670 CACTGCAACCTCCTCCCTTCAGG - Intergenic
1010173745 6:73002007-73002029 CACCTCAGCCTCCTGAGAGCTGG - Intronic
1010833003 6:80553773-80553795 CACTACAGCCTCCTAAATGCAGG - Intergenic
1011670989 6:89682831-89682853 CACGTCAACCTCCTGAGTGCTGG - Intronic
1011687382 6:89834501-89834523 CACTGCAACCTCCTCCTTTCAGG + Intronic
1012034141 6:94110049-94110071 CACTGCAGCTTTCTGAATCCAGG - Intergenic
1012195690 6:96338481-96338503 AACCTCTGCCTCCTGAGTTCAGG - Intergenic
1013211957 6:107994968-107994990 CACTGCAGCCTCCACCTTTCTGG - Intergenic
1013263171 6:108467321-108467343 CACTGCAACTTCCTGCTTTCCGG + Intronic
1013485111 6:110589520-110589542 AACCTCAGCCTCCTGGGTTCAGG + Intergenic
1014233275 6:118928160-118928182 CACCTCAGCCTCCCCAGTTCTGG - Intronic
1014401569 6:120996596-120996618 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1014655926 6:124103970-124103992 CGCCTCAGCCTCCTGAGTACTGG - Intronic
1014898503 6:126933539-126933561 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1015143593 6:129961253-129961275 CACTGCAGCCTCCGGCTCTCAGG + Intergenic
1015534929 6:134258176-134258198 CACTGCACCCTCCTCATTCCTGG + Intronic
1015768320 6:136743012-136743034 CACTGCAGCCTTCAGCTTTCTGG - Intronic
1016223101 6:141699948-141699970 CACATCAGCCTCCAGAGTTGCGG + Intergenic
1016407745 6:143748145-143748167 AACTTCAGCCTCCTGGGTTCAGG + Intronic
1016449201 6:144163830-144163852 CACCTCAGCCTCCTGGGTACTGG - Intronic
1016504326 6:144761530-144761552 CACCTCAGCCTCCTGACTGCTGG - Intronic
1016798702 6:148146146-148146168 TACTTCAGCCTCCTGAGTGGCGG - Intergenic
1016854607 6:148654625-148654647 CACTTCAGCCTCCCAAATTCTGG - Intergenic
1016949890 6:149569107-149569129 AACTTCTGCCTCCTGGGTTCAGG + Intronic
1017154890 6:151314274-151314296 CACTTCAGCCTCCCAAGTGCTGG + Intronic
1017754037 6:157514683-157514705 CCCTGCAGCCTCTTGACTGCTGG + Intronic
1017841393 6:158225534-158225556 TGCTGCAGCCTCCTGAGTAGTGG - Intergenic
1017886047 6:158600245-158600267 AACCGCTGCCTCCTGGGTTCAGG + Intronic
1017931553 6:158959746-158959768 CACTGCAGCCCCCTAGGCTCTGG + Intergenic
1017967832 6:159281701-159281723 AACTTCTGCCTCCTGGGTTCAGG + Intergenic
1018751177 6:166807750-166807772 CCCTGCAGCCACCTGAGCTCAGG - Intronic
1019192315 6:170259435-170259457 CACTGCACCCCAGTGAGTTCAGG + Intergenic
1019592460 7:1842574-1842596 AACTGCAGCCACCTGAGCCCCGG + Intronic
1019745487 7:2698143-2698165 CACAGTAGCCTCCTGAGTAGTGG - Intronic
1019780412 7:2936647-2936669 CACTTCAGCCTCCTGGGTAGCGG - Intronic
1019912207 7:4107311-4107333 CCCGGCAGCCTCCTGCCTTCCGG - Intronic
1020132728 7:5568637-5568659 AACTTCCGCCTCCTGGGTTCAGG - Intergenic
1020168784 7:5828528-5828550 CACCTCAGCCTCATGACTTCAGG + Intergenic
1020228367 7:6297967-6297989 CACTGCAGCCTCCAGCTTCCAGG - Intergenic
1020887197 7:13833013-13833035 CACTGCAACCTCCGGATCTCGGG + Intergenic
1021215610 7:17912483-17912505 CACTGCAACCTCCTGCCTCCCGG + Intronic
1021254791 7:18377644-18377666 AATAGCAGCCTCCAGAGTTCAGG + Intronic
1021720573 7:23500728-23500750 AACCTCTGCCTCCTGAGTTCAGG + Intergenic
1021745089 7:23732195-23732217 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1021819152 7:24479447-24479469 AACTTCCGCCTCCTGGGTTCAGG + Intergenic
1021825913 7:24551119-24551141 CACCTCTGCCTCCTGGGTTCAGG - Intergenic
1021930549 7:25577248-25577270 CACTGCAGCCTCCCCCTTTCAGG + Intergenic
1022010783 7:26306485-26306507 CACTGCAGCTTCCTGAGCTCAGG + Intronic
1022171556 7:27836711-27836733 CACCTCAGCCTCCTGCTTTCTGG - Intronic
1022354065 7:29595093-29595115 AACCTCCGCCTCCTGAGTTCAGG - Intergenic
1022788001 7:33658545-33658567 CACTGCAACCTCCGGCTTTCGGG + Intergenic
1022871924 7:34488943-34488965 CACTGAAGTCTCCTAAGTCCGGG - Intergenic
1023050878 7:36250106-36250128 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1023388180 7:39681398-39681420 CACTGGAGCCTCCCGGGTTCAGG + Intronic
1023490956 7:40741194-40741216 CACTGAACCCTCCTGGGTTCAGG - Intronic
1023504320 7:40884444-40884466 CACAGCACCCCACTGAGTTCAGG - Intergenic
1023513839 7:40980776-40980798 AACTTCTGCCTCCTGAGCTCAGG + Intergenic
1023625681 7:42113099-42113121 CACTGCAGCCTCCACCTTTCAGG - Intronic
1023710305 7:42985845-42985867 CACTGCAACCTCCACATTTCTGG + Intergenic
1024707366 7:51974828-51974850 CACTGCAGCCTCCTGCTCCCGGG + Intergenic
1024858673 7:53812208-53812230 CACTGCAACCTCCGTATTTCTGG + Intergenic
1024947239 7:54821099-54821121 CACTTCAGCCTCCAAAGTGCTGG - Intergenic
1025012261 7:55406983-55407005 CACTTTCCCCTCCTGAGTTCTGG - Intronic
1025056348 7:55768455-55768477 CACTGCAACCTCCTGCCTCCTGG - Intergenic
1026470220 7:70688708-70688730 TGCAGCAGCCTCCTGAGTACTGG - Intronic
1026608865 7:71839448-71839470 AACTGCCACCTCCTGGGTTCAGG - Intronic
1026674625 7:72418507-72418529 CACTGCACCCTCCAGGGCTCTGG + Intronic
1026761621 7:73131122-73131144 CACTGCAGCCTCTTAACTCCTGG - Intergenic
1026788252 7:73315432-73315454 CACTGCAGCCTCCCAACTCCTGG + Intronic
1026793711 7:73352045-73352067 CACTGCAGCCTCCTGGGCTCAGG + Intronic
1026888743 7:73969887-73969909 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1026932399 7:74230842-74230864 CACCTCAGCCTCCTAAGTGCTGG - Intergenic
1026957986 7:74389821-74389843 CACTGCAGCCTCCTCCTCTCGGG - Intronic
1027037961 7:74939938-74939960 CACTGCAGCCTCTTAACTCCTGG - Intergenic
1027085600 7:75261537-75261559 CACTGCAGCCTCTTAACTCCTGG + Intergenic
1027135377 7:75620302-75620324 AACTTCTGCCTCCTGAGCTCAGG - Intronic
1027155391 7:75763827-75763849 GACTGAAGCCTCCTGCGTTTGGG - Intergenic
1027245307 7:76363101-76363123 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1028759570 7:94480473-94480495 CACCTCAGCCTCCTGAGTAATGG + Intergenic
1028759816 7:94483460-94483482 CACCTCAGCCTCCTGAGTAATGG + Intergenic
1028882447 7:95895053-95895075 CACTGCAGCTTTCTGAATCCCGG - Intronic
1029155260 7:98512887-98512909 CACGTCAGCCTCCTGAGGTATGG + Intergenic
1029483046 7:100824417-100824439 CTCTGCACCCGCCTGATTTCTGG + Intronic
1030003296 7:105089278-105089300 AACTTCTGCCTCCTGGGTTCAGG + Intronic
1030014176 7:105201768-105201790 CATCTCAGCCTCCTGAGTCCTGG - Intronic
1030035674 7:105406286-105406308 CACTGCAACCTCCTGCCTCCTGG - Intergenic
1030361759 7:108602645-108602667 CACTTCAGCCTCCTGAGTACAGG + Intergenic
1030497963 7:110323523-110323545 CACATCAGCCTCCTGAGTATGGG + Intergenic
1030516167 7:110541030-110541052 CACTGCAGCAACCTTAGTTCAGG + Intergenic
1030681015 7:112433931-112433953 CACTTCAGCCTCCTGAGTAGCGG + Intronic
1030888892 7:114972740-114972762 CACTGTAGCCTCCCGTGTACAGG + Intronic
1031841944 7:126752942-126752964 AACTGCATCCTCCTGAGGACAGG + Intronic
1032035170 7:128516239-128516261 CACTGCAACCTCCCAGGTTCAGG - Intergenic
1032114613 7:129106361-129106383 CACTGCAGCCTCCACATCTCAGG + Intergenic
1033054415 7:138036646-138036668 AACCTCCGCCTCCTGAGTTCAGG + Intronic
1033101371 7:138475590-138475612 CACTGCAACCTCCAGGGTTCAGG + Intronic
1033239468 7:139665149-139665171 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1033322595 7:140353399-140353421 CACCGCAACCTCCTGGGTTCAGG - Intronic
1033328780 7:140400899-140400921 CACTGCAGCCTCCAAAGGTGCGG - Intronic
1034028953 7:147738734-147738756 AACTTCTGCCTCCTGGGTTCAGG + Intronic
1034495412 7:151418041-151418063 TGCTTCAGCCTCCTGAGTACGGG - Intergenic
1034637424 7:152578343-152578365 CACTGCAACCTCCTGCCTCCTGG + Intergenic
1034916045 7:155039882-155039904 CACCTCAGCCTCCCAAGTTCTGG + Intergenic
1035197843 7:157237974-157237996 CACTGCAGCCTCTACATTTCAGG - Intronic
1035217837 7:157383079-157383101 CACTGCAGCCTCCCGCCTCCTGG + Intronic
1035321626 7:158033407-158033429 CCTTGCAGCCTCCTGAGTCACGG + Intronic
1035461706 7:159043165-159043187 CAGTGCAGCTTCCTGAGGTGGGG + Exonic
1036194566 8:6702520-6702542 CACTGCAACCTCCTGGGCTCAGG + Intergenic
1036423123 8:8616531-8616553 CATTGCAGCCTCCTTACTTTTGG + Intergenic
1036614418 8:10377691-10377713 CACTGCAGCTGCCCGATTTCAGG + Intronic
1036812076 8:11874043-11874065 CACTGCAGCCTCCAGCTCTCAGG - Intergenic
1037067004 8:14594059-14594081 CACGTCAGCCTCCTGAGTAGTGG - Intronic
1037448063 8:18987735-18987757 CACTGCTGCCTCTTGGGCTCAGG - Intronic
1037564688 8:20107872-20107894 AACCCCAGCCTCCTGGGTTCAGG - Intergenic
1037773665 8:21818506-21818528 CACCTCAGCCTTCTGAGTTGGGG - Intergenic
1038094920 8:24297693-24297715 CCCTGCTGCCTCCTTAATTCAGG - Intronic
1038131189 8:24733295-24733317 AACTTCCGCCTCCTGGGTTCAGG - Intergenic
1038537235 8:28362014-28362036 CACTGCAGCCTCCCGCCTCCTGG - Intronic
1038616084 8:29096411-29096433 CACTTCAGCCTCCTGAGTAGAGG + Intronic
1038766750 8:30435879-30435901 CACTGCAGCCTCCAAACTCCTGG + Intronic
1038961022 8:32520235-32520257 CACTGCAGCCTCCAAATTCCGGG + Intronic
1039048874 8:33474692-33474714 CACCTCAGCCTCCTGAGTGGCGG - Intronic
1039865009 8:41492546-41492568 TACTTCAGCCTCCTGAGTAGCGG - Intronic
1039924045 8:41912972-41912994 CACTGCAGCTTTCTGAATCCCGG - Intergenic
1040074750 8:43218378-43218400 CACTGCAGCCTCTTGACTCCTGG + Intergenic
1040501635 8:48010310-48010332 CACTGCACCCTCCTCACCTCAGG + Intronic
1040641977 8:49345726-49345748 CACTGCAGCCTCCTTCCCTCTGG - Intergenic
1040900840 8:52415429-52415451 CACTTCAGCCTCCTAAGTAGTGG - Intronic
1041115902 8:54536573-54536595 CACCTCAGCCTCCTGAGTAGGGG + Intergenic
1041213153 8:55572949-55572971 CACTGCAGCTTTCTGAATCCCGG - Intergenic
1042176340 8:66040306-66040328 AACCTCCGCCTCCTGAGTTCAGG - Intronic
1042233317 8:66581560-66581582 CACCTCAGCCTCTCGAGTTCTGG - Intronic
1042269503 8:66941126-66941148 CTCTGCGGCCTCCTGTGTCCTGG + Intergenic
1042888461 8:73579086-73579108 CAGTGTAGCCTCCTGGTTTCAGG + Intronic
1043464411 8:80490329-80490351 CACTGCAGCCTCCTGGGCTCAGG + Intronic
1044036505 8:87310239-87310261 CACCTCAGCTTCCTGAGTGCTGG - Intronic
1044604967 8:94040516-94040538 CACTTCAGCCTCCTCAGTACTGG + Intergenic
1045627148 8:104067469-104067491 CACTGCAGCCTCCCAACTCCTGG + Intronic
1045755708 8:105538761-105538783 CACTGCAGCCACCTGAAGTGTGG - Intronic
1045905557 8:107340612-107340634 CACTGCAGCCTCTTGGGCTCCGG + Intronic
1045995109 8:108352884-108352906 AACTTCCGCCTCCTGGGTTCAGG - Intronic
1046872106 8:119215171-119215193 CATCTCAGCCTCCTGAGATCTGG + Intronic
1047155056 8:122307655-122307677 CACCTCAGCCTCCAGAGTGCTGG - Intergenic
1047253737 8:123200282-123200304 CACTCCATCCTCCGGTGTTCTGG - Intronic
1047529728 8:125664081-125664103 CACTGCAGCCTCCGCATCTCGGG - Intergenic
1047614301 8:126550575-126550597 CACCTCAGCCTCCTGAGTGCTGG + Intergenic
1048475215 8:134736707-134736729 CACCGCAGCCTCCTGAGTAGTGG + Intergenic
1048879544 8:138861141-138861163 AACTGCAGCCTCCTGGGTCAGGG - Intronic
1048994447 8:139784490-139784512 AACCTCAGCCTCCTGGGTTCAGG - Intronic
1049177758 8:141204893-141204915 CACTGAAGCATCCTGGGCTCTGG - Intergenic
1049332341 8:142061360-142061382 GACTCCAGCCTCCAGAGTTGTGG + Intergenic
1049760021 8:144327720-144327742 CACAGAAGCCTCTTGAGTCCCGG - Intergenic
1049992896 9:1006704-1006726 CACTGCAACCTCCCGACTCCTGG + Intergenic
1050013521 9:1209325-1209347 CTCTGCAGCCCCTTGAGATCAGG + Intergenic
1050193733 9:3057850-3057872 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1050302443 9:4273477-4273499 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1050348259 9:4715141-4715163 CACTGCAGCCTCCTCATCCCAGG - Intronic
1050456304 9:5837971-5837993 CACCTCAGCCTCCTGAGTACAGG - Intergenic
1050870592 9:10564111-10564133 CACCTCAGCCTCCCGAGTGCTGG + Intronic
1050925980 9:11263440-11263462 AACTTCCGCCTCCTGGGTTCAGG - Intergenic
1050990876 9:12150173-12150195 CACCTCAGGCTCCTGAGTGCTGG + Intergenic
1051248360 9:15134837-15134859 CACTTCAGCCTCCCGAGTACCGG - Intergenic
1051631839 9:19147815-19147837 CACTGCAACCCCCTGCCTTCCGG - Intronic
1051637641 9:19195402-19195424 CACCTCCGCCTCCTGGGTTCAGG - Intergenic
1051657351 9:19395803-19395825 CACTGCAACCCCCTGCCTTCCGG + Intergenic
1051705758 9:19878192-19878214 AACTGCAGCCGCCTAAATTCTGG - Intergenic
1051792893 9:20828055-20828077 TACCTCAGCCTCCTGAGTGCTGG - Intronic
1051871045 9:21738079-21738101 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1051884143 9:21872240-21872262 CACTGCAACCTCCCGCCTTCTGG - Intronic
1052080411 9:24199019-24199041 CACTTCAGCCTCCCAAGTGCTGG + Intergenic
1052810484 9:33054265-33054287 CACTTCAGCCTTCTGAGTACGGG + Intronic
1052858141 9:33419725-33419747 AACCTCTGCCTCCTGAGTTCAGG - Intergenic
1053033909 9:34808661-34808683 CACTGCATCTTCCAGAGTTGGGG + Intergenic
1054151387 9:61608609-61608631 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1054724185 9:68633934-68633956 CACCTCAGCCTCCTGAGTACTGG - Intergenic
1055026178 9:71724210-71724232 CACCTCTGCCTCCTGGGTTCAGG - Intronic
1055556320 9:77477231-77477253 CACCACAGCCTCCTGAGTACTGG - Intronic
1056145514 9:83725090-83725112 CACCTCTGCCTCCTGGGTTCAGG + Intergenic
1056226223 9:84498028-84498050 CACTGCAGCCTCCCATGCTCAGG + Intergenic
1056278744 9:85019081-85019103 CATTTCAGCCTCTTGGGTTCTGG + Intronic
1056680670 9:88714828-88714850 AACTCCTGCCTCCTGGGTTCAGG - Intergenic
1056966337 9:91165776-91165798 CACTGCAGCCTCGAGTTTTCGGG + Intergenic
1056967631 9:91178391-91178413 CCCTGCTGGCTGCTGAGTTCTGG - Intergenic
1057100649 9:92355913-92355935 CACAGAAGACTCCTAAGTTCAGG - Intronic
1057264879 9:93609776-93609798 CACTGCAACCTCCTGGGTTGAGG + Intronic
1057410279 9:94811622-94811644 CAGTGCACCCTGCTGAGCTCTGG - Intronic
1057789108 9:98110966-98110988 CACTGCAACCTCCTGGGCTTAGG - Intronic
1057906408 9:98987013-98987035 CACAGCAGCCTCCTGTCTCCAGG - Intronic
1058457983 9:105155947-105155969 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1058735759 9:107892564-107892586 AACTTCTGCCTCCTGGGTTCAGG - Intergenic
1059008358 9:110428953-110428975 CACTTCAGCCTCCTGAGTGCAGG - Intronic
1059189593 9:112311871-112311893 CACTGCAGCCTCCAACGTCCTGG - Intronic
1059973617 9:119692993-119693015 CACTGCAGCCTCCTGGTTTCCGG - Intergenic
1060353347 9:122879310-122879332 AACCTCTGCCTCCTGAGTTCAGG - Intronic
1060427689 9:123520076-123520098 AACTGCAGCCTCATGAGCTCAGG - Intronic
1060470829 9:123946815-123946837 CACCTCAGCCTCCTGAGCTACGG - Intergenic
1060648244 9:125301181-125301203 CACCTCAGCCTCCTGAGTGCTGG + Intronic
1060699300 9:125736970-125736992 CACTGCAACCTCCTGGGTTCAGG + Intergenic
1060804636 9:126566968-126566990 CACTTCAGCCTCTTGAGGTTGGG + Intergenic
1060844564 9:126825919-126825941 CACTGCAACCTCCTGCCTCCCGG + Intronic
1060955573 9:127636791-127636813 CACTGCAACCTCCGCAGTTCAGG + Intronic
1060962855 9:127693459-127693481 CACTGCAGTCTTCTCAGGTCAGG - Intronic
1060986355 9:127821353-127821375 CACTGCAGCCTCCTCCTCTCAGG - Intronic
1061186370 9:129056804-129056826 CACTGCACCCAGCTGAGCTCAGG + Intronic
1061228185 9:129293416-129293438 CACTGCAGCCTCCAACTTTCTGG + Intergenic
1061244322 9:129393739-129393761 AACTTCCGCCTCCTGGGTTCAGG + Intergenic
1061315986 9:129796116-129796138 CACTGCAAACTCCTGGGCTCAGG + Intergenic
1061463468 9:130758897-130758919 CACTACAGCCTTCTGAATCCCGG - Intronic
1062320947 9:135990303-135990325 CCCTGCAGGCTCCTGGATTCCGG + Intergenic
1062448669 9:136606469-136606491 CCCAGCAGCCTCATGAGTTTGGG - Intergenic
1185573834 X:1154668-1154690 CACCTCTGCCTCCTGGGTTCAGG + Intergenic
1185944422 X:4358368-4358390 AGCCTCAGCCTCCTGAGTTCAGG - Intergenic
1186736375 X:12469323-12469345 CACTGCAGCCTCCAGCTTCCAGG + Intronic
1186737245 X:12478467-12478489 CAATGCAACCTCCTGAGTAGTGG - Intronic
1187343362 X:18441299-18441321 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1187554444 X:20338676-20338698 CACTGCTGCCTCCTGCCATCAGG + Intergenic
1187719664 X:22137817-22137839 AACTGCAGCCTCCTGCATTTTGG + Intronic
1188423524 X:30017933-30017955 CACTGCGGCCTTCTGACATCAGG + Intergenic
1188441479 X:30218260-30218282 CAGTGCGGCCTCCTGTCTTCTGG - Intronic
1188892247 X:35625602-35625624 TACCTCAGCCTCCTGAGTGCTGG - Intergenic
1188896772 X:35678561-35678583 CACTTCAGCCTCCCAAGTGCTGG - Intergenic
1189030509 X:37444771-37444793 CCATGTACCCTCCTGAGTTCTGG - Intronic
1190078019 X:47332978-47333000 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1190247208 X:48698512-48698534 CACTGCATCCTACTGAGATGGGG + Intronic
1190306619 X:49086705-49086727 CGCTTCAGCCTCCTGAGTAGTGG + Intronic
1190320172 X:49175444-49175466 CACTGCAGCCTCAAAAGTTTTGG - Intronic
1190389509 X:49918246-49918268 CACCTCCGCCTCCTGGGTTCAGG + Intergenic
1190688074 X:52891797-52891819 CTGTGCAGCCTGCAGAGTTCAGG + Intronic
1190697908 X:52963995-52964017 CTGTGCAGCCTGCAGAGTTCAGG - Intronic
1190754682 X:53391238-53391260 CACTGCAGCCTCTTGCCTCCTGG - Intronic
1190754850 X:53392530-53392552 AACCTCAGCCTCCTGGGTTCAGG + Intronic
1190766788 X:53481785-53481807 CCCTGCACCCACCTTAGTTCAGG + Intergenic
1190822980 X:53991752-53991774 CACTTCAGCCTCCAGAGTGCTGG - Intronic
1191605350 X:63056837-63056859 CACTGCAGCTTGCTGAGATGGGG + Intergenic
1191755094 X:64584183-64584205 CACTGCAGCCTTGTGGGCTCAGG + Intergenic
1192116432 X:68416154-68416176 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1192239824 X:69320209-69320231 CACTGCTGGCTCCTGACTCCTGG + Intergenic
1192677112 X:73209626-73209648 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1193118055 X:77794643-77794665 CACCTCAGCCTCCTGAGTGCTGG - Intergenic
1193976758 X:88129740-88129762 CACCTCAGCCTCCTGAGTACTGG - Intergenic
1194302070 X:92200985-92201007 CACTGCAGCCTCCAAAATGCTGG + Intronic
1194652795 X:96535374-96535396 CACCTCAGCCTCCAAAGTTCTGG + Intergenic
1194741325 X:97578038-97578060 CACTGCAGCCTTTTGAGCTGGGG + Intronic
1195927859 X:110044551-110044573 CACCACAGCCTCCTGAGTAGCGG + Intronic
1196255302 X:113511370-113511392 CACTGCAACCTCCTGCCTCCCGG + Intergenic
1196742221 X:119035356-119035378 CACTGCAACCTCCTCTGTGCGGG + Intergenic
1196780168 X:119376488-119376510 AAGTGCAGCCTTCTGACTTCGGG - Intergenic
1196839196 X:119842496-119842518 AACTTCCGCCTCCTGGGTTCAGG - Intronic
1197734750 X:129842733-129842755 CTCTGCAACTTCCTGAGTCCGGG + Intronic
1198379365 X:136069611-136069633 CACTGCAGCCTCCCAATTACTGG - Intergenic
1198884930 X:141324161-141324183 CACCTCAGCCTCCAAAGTTCTGG + Intergenic
1199816003 X:151397340-151397362 CACTGCAGCCTCCTGAGTTCAGG + Exonic
1200781084 Y:7216328-7216350 CACCTCAGCCTCCTGAGTAGGGG + Intergenic
1201265098 Y:12198691-12198713 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1201914495 Y:19167774-19167796 CACCTCAGCCTCCTGTGTTGGGG - Intergenic
1201920222 Y:19226037-19226059 CACTGCAGCCTCCTCCTTCCAGG + Intergenic
1202271265 Y:23076849-23076871 CACTGCAGCCTCCAAATCTCAGG + Intergenic
1202294761 Y:23343833-23343855 CACTGCAGCCTCCAAATCTCAGG - Intergenic
1202424260 Y:24710593-24710615 CACTGCAGCCTCCAAATCTCAGG + Intergenic
1202446529 Y:24959492-24959514 CACTGCAGCCTCCAAATCTCAGG - Intergenic