ID: 1199818084

View in Genome Browser
Species Human (GRCh38)
Location X:151418068-151418090
Sequence GTGTGATTAGAATGGATCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199818080_1199818084 8 Left 1199818080 X:151418037-151418059 CCCCAGAGTTGGTAGAAACAAAA No data
Right 1199818084 X:151418068-151418090 GTGTGATTAGAATGGATCCTTGG No data
1199818081_1199818084 7 Left 1199818081 X:151418038-151418060 CCCAGAGTTGGTAGAAACAAAAT No data
Right 1199818084 X:151418068-151418090 GTGTGATTAGAATGGATCCTTGG No data
1199818082_1199818084 6 Left 1199818082 X:151418039-151418061 CCAGAGTTGGTAGAAACAAAATC No data
Right 1199818084 X:151418068-151418090 GTGTGATTAGAATGGATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199818084 Original CRISPR GTGTGATTAGAATGGATCCT TGG Intergenic
No off target data available for this crispr