ID: 1199826550

View in Genome Browser
Species Human (GRCh38)
Location X:151505982-151506004
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199826545_1199826550 -4 Left 1199826545 X:151505963-151505985 CCTTTCTTAGCCTTAATTGCCCC No data
Right 1199826550 X:151505982-151506004 CCCCACTGGGCACTGTGTTTTGG No data
1199826544_1199826550 18 Left 1199826544 X:151505941-151505963 CCACAGTAGGGAACACGCTCTGC No data
Right 1199826550 X:151505982-151506004 CCCCACTGGGCACTGTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199826550 Original CRISPR CCCCACTGGGCACTGTGTTT TGG Intergenic
No off target data available for this crispr