ID: 1199828384

View in Genome Browser
Species Human (GRCh38)
Location X:151523536-151523558
Sequence CCACCCTGCCTGGCAAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199828384_1199828389 -9 Left 1199828384 X:151523536-151523558 CCCTTGTTTGCCAGGCAGGGTGG No data
Right 1199828389 X:151523550-151523572 GCAGGGTGGGCCTTGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199828384 Original CRISPR CCACCCTGCCTGGCAAACAA GGG (reversed) Intergenic
No off target data available for this crispr