ID: 1199829683

View in Genome Browser
Species Human (GRCh38)
Location X:151537242-151537264
Sequence CCTAGTAAACAGACATAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199829678_1199829683 18 Left 1199829678 X:151537201-151537223 CCTTTAAAAGACAGGGCTCAGAA No data
Right 1199829683 X:151537242-151537264 CCTAGTAAACAGACATAGGTGGG No data
1199829675_1199829683 29 Left 1199829675 X:151537190-151537212 CCAGGTGGAGTCCTTTAAAAGAC No data
Right 1199829683 X:151537242-151537264 CCTAGTAAACAGACATAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199829683 Original CRISPR CCTAGTAAACAGACATAGGT GGG Intergenic
No off target data available for this crispr