ID: 1199833175

View in Genome Browser
Species Human (GRCh38)
Location X:151563660-151563682
Sequence CAGAGTGCAAAGCGCGTGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199833175 Original CRISPR CAGAGTGCAAAGCGCGTGGT GGG (reversed) Exonic
902896088 1:19481170-19481192 CAGAGTGCATAGCATGTGGCTGG + Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
915620668 1:157081476-157081498 CAGGGTGCCAAGCGGGTGTTGGG + Intergenic
922901179 1:229137909-229137931 CAGAGGGCTAAGTTCGTGGTTGG + Intergenic
1062961376 10:1575934-1575956 CAGAGCACAAAGCGCATGGGAGG + Intronic
1073552196 10:104414057-104414079 CAGAGGCCAAAGGGAGTGGTGGG + Intronic
1074753889 10:116610451-116610473 CAGGGTGCAAGGCGAGTGCTCGG + Intergenic
1078840441 11:15072494-15072516 CAGAAGGCAGAGCGTGTGGTGGG + Intronic
1085765056 11:79275433-79275455 CAGAGTGCAAAGCGCATTTCTGG - Intronic
1085788075 11:79472651-79472673 CACAGTGCCAAGCACGTCGTAGG - Intergenic
1086143811 11:83528404-83528426 CAGTGTGCAAAGGTCATGGTGGG - Intronic
1088695360 11:112361709-112361731 CAGTGTGCAGAGAGTGTGGTGGG + Intergenic
1089333808 11:117708831-117708853 CAGAGTACAAAGTGGGGGGTGGG + Intronic
1089975554 11:122728691-122728713 CACAGTGCAAAGCGCATTCTAGG - Intronic
1090050806 11:123377394-123377416 AAGAGAGCAAAATGCGTGGTGGG + Intergenic
1090344195 11:126054785-126054807 CAGAGTGCAAAGAAAGGGGTGGG + Intronic
1091047859 11:132341035-132341057 AAGAGGGCAAAGCGTGGGGTTGG + Intergenic
1091332160 11:134738088-134738110 GGGAGGGCAAAGCGCGTGGAAGG + Intergenic
1100832882 12:98534089-98534111 CAGAATCCCAAGCGCTTGGTGGG - Exonic
1102217619 12:111172585-111172607 CAGAGTGGAAAGCGCTGGCTGGG - Intronic
1105657125 13:22453748-22453770 CAGAGTGCAAAGTGCCTGGCCGG + Intergenic
1112183264 13:97105488-97105510 CAGAGTGCATACCACCTGGTAGG + Intergenic
1120551103 14:85874069-85874091 CATAGTGCAAAGAGTGTTGTTGG + Intergenic
1124635455 15:31361888-31361910 AAGAGGGCAGAGCACGTGGTGGG - Intronic
1130159798 15:81387265-81387287 CACAGTGCATAGGGCGTAGTAGG + Intergenic
1134808418 16:17145584-17145606 CACAGTGCCAAGCGCTTGATGGG + Intronic
1137488818 16:48913723-48913745 CAGAATGCAAAGGGAGAGGTAGG + Intergenic
1142008383 16:87701127-87701149 CGGAATGCACAGCGCGTGGGGGG + Intronic
1145056959 17:19709041-19709063 CATAGTGCACAGTGCCTGGTAGG + Intronic
1147742991 17:42679289-42679311 CAGAGAGCCAAGCGCGGGGCAGG + Exonic
1151625161 17:75271545-75271567 GAGCCTGCAGAGCGCGTGGTGGG + Intergenic
1162380265 19:10327771-10327793 CAGAGTCCACAGCGAGTGCTGGG + Intronic
1166738399 19:45099566-45099588 CAGTGTGCAAAGGGCCTGGGAGG - Intronic
925154156 2:1637388-1637410 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154165 2:1637462-1637484 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154201 2:1637684-1637706 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154217 2:1637759-1637781 CAGAGTGGACAGCGTGTGGCAGG - Intronic
935869970 2:107437196-107437218 CAGAGTGCAATTCACTTGGTAGG + Intergenic
942335622 2:174881827-174881849 CAGAGTGCAAATCGGGTAGGAGG + Intronic
1171428319 20:25062521-25062543 CTGAGTGCACAGGGAGTGGTTGG - Intergenic
1174399289 20:50267372-50267394 CAGAGTGCCCAGCATGTGGTAGG - Intergenic
1176896392 21:14383464-14383486 CAGAATGCAAAGCGCGGGGCGGG - Intronic
1177171766 21:17662884-17662906 CAGAGGGCCTGGCGCGTGGTAGG - Intergenic
1178663326 21:34524761-34524783 TAGAATGCAAAGCTCGAGGTGGG + Intronic
1179443956 21:41418626-41418648 CACAGTGCCAGGCGCGTGCTAGG - Intergenic
1179949769 21:44703106-44703128 CATTGTGCAAGGCACGTGGTGGG - Intronic
1181632282 22:24157460-24157482 TAGAGTGCAAAGAGCATGATAGG + Intronic
1184102257 22:42347055-42347077 AAGAGTGCAAAGCGCATAGTAGG + Intergenic
1184780981 22:46649299-46649321 CTGGGTGCCAAGCGCTTGGTTGG + Intronic
950049993 3:9980868-9980890 CAGAGTGCAAGGCACATGATAGG + Intronic
950056006 3:10025276-10025298 CAGAGTGCAAGGCACATGGTAGG - Intergenic
950152392 3:10697874-10697896 CACAGGGCAAGGCACGTGGTAGG - Intronic
950566151 3:13770827-13770849 CACAGTGCCAGGCACGTGGTGGG - Intergenic
954418363 3:50405343-50405365 CAGAGAGCAAGGGCCGTGGTGGG + Intronic
954888624 3:53901771-53901793 GAGAGTGCAAAGCGTGAGGATGG - Intergenic
955997837 3:64696054-64696076 CAAAGTGCATAGCAGGTGGTAGG - Intergenic
961869056 3:129975057-129975079 CAGAGTCCGCAGCGCGGGGTGGG + Intronic
973079296 4:45970309-45970331 CAGAGTGCTAACCTCGTTGTTGG + Intergenic
978107051 4:104916080-104916102 CGGAGTGCAATGTGCTTGGTAGG + Intergenic
981226617 4:142302618-142302640 CAGAGCACAAAGCACATGGTTGG + Intronic
986735081 5:10662368-10662390 CAGGGAGCACAGCGCATGGTTGG + Intergenic
992531285 5:77654047-77654069 CAGAGAGGAAAGGGCCTGGTGGG - Intergenic
996192910 5:120567434-120567456 CAGAGTACACAGAGGGTGGTAGG + Intronic
997640804 5:135447682-135447704 CAGAGTGCTAAGCACATGGTAGG + Exonic
1000595293 5:163208677-163208699 CAGAGGGCAAAGCATGTGGCAGG + Intergenic
1002434075 5:179220654-179220676 CAGAGGGCATAGAGCGTGGAGGG - Intronic
1007448089 6:41922106-41922128 CATAGCGCAAAGCTCGTAGTGGG - Intronic
1007945324 6:45821338-45821360 CACAGTGCAGATAGCGTGGTTGG + Intergenic
1017031775 6:150230229-150230251 CAAAGTGTGAAGCGGGTGGTGGG - Intronic
1018614749 6:165676484-165676506 CAGGTTGGAAAGGGCGTGGTCGG + Intronic
1019104806 6:169659636-169659658 CAGCCTGCAAAGTGTGTGGTGGG - Intronic
1019573320 7:1724185-1724207 CACAGTGCCTGGCGCGTGGTAGG + Intronic
1020979265 7:15047095-15047117 CAGGGTGCAAAGTGCATTGTGGG - Intergenic
1022776914 7:33536260-33536282 CAGAGTGGCAAGCGGGTCGTCGG - Intronic
1023652757 7:42388791-42388813 CAGAGTGGAAAGGGCGTGTGAGG - Intergenic
1040862312 8:52011917-52011939 CACAGTGCAAGGCATGTGGTGGG + Intergenic
1041017859 8:53609372-53609394 CCGAGTGCCAAGCGTGTGCTGGG - Intergenic
1049564241 8:143329968-143329990 CAGAGTGAGAGGCTCGTGGTGGG + Intronic
1052878248 9:33583616-33583638 GAGGGTGCAAAGCTCTTGGTGGG - Intergenic
1053497735 9:38560591-38560613 GAGGGTGCAAAGCTCTTGGTGGG + Intronic
1056236776 9:84602389-84602411 CAGAGTGCCAGGCACATGGTGGG + Intergenic
1056245730 9:84693181-84693203 CACAGTCAAAAGCACGTGGTCGG - Intronic
1056262635 9:84864019-84864041 CAGAGAGCAAATCACTTGGTTGG + Intronic
1061259829 9:129474037-129474059 CAGAGTGCATAGGGCGTGCAGGG + Intergenic
1062150699 9:135017357-135017379 CAGAGGACAAAGCCCCTGGTTGG + Intergenic
1188313345 X:28644511-28644533 CTGAGTGCAAGGCGCTAGGTGGG - Intronic
1189352225 X:40284359-40284381 AAGAGTGCAAAGAGTGTTGTAGG - Intergenic
1196257778 X:113542523-113542545 CAGAGTGCAAAGTTAATGGTTGG + Intergenic
1199833175 X:151563660-151563682 CAGAGTGCAAAGCGCGTGGTGGG - Exonic