ID: 1199841223

View in Genome Browser
Species Human (GRCh38)
Location X:151651407-151651429
Sequence AAATCCATTGTGTCAGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199841223 Original CRISPR AAATCCATTGTGTCAGGAGG TGG Intronic
901001713 1:6152082-6152104 AACTCCATTTGGGCAGGAGGTGG - Intronic
901106740 1:6762239-6762261 AAATCAGATGTGTCAGGAGTCGG - Intergenic
903545342 1:24120465-24120487 GAATCCATGGTGTTAGGAGGTGG + Exonic
904406415 1:30292244-30292266 AAATACATTGTCTCAGGCTGTGG - Intergenic
909099298 1:71331299-71331321 AAATGCATAGTGTCAAGAGGTGG - Intergenic
909508282 1:76420140-76420162 AAATCATTTGGGTCAGCAGGTGG - Intronic
910234064 1:85016590-85016612 AAAATCATTATGGCAGGAGGAGG + Intronic
910867655 1:91802877-91802899 GAATCCATTGGGTGAGGAGAGGG - Intronic
911438868 1:97899525-97899547 AAATCAATTGTGCCTGGAGGTGG + Intronic
912114322 1:106386218-106386240 AAATACATTTATTCAGGAGGAGG - Intergenic
913203637 1:116516227-116516249 GAACCCATTGTGGCAGCAGGGGG - Intronic
916800708 1:168213649-168213671 AGATCAATTGTTTCAAGAGGGGG + Intergenic
917926420 1:179792900-179792922 AAATACAGTGTGACAGGAGCTGG + Intronic
918959549 1:191255771-191255793 GAATCCTTTGTCTCAGCAGGAGG - Intergenic
919703496 1:200654828-200654850 AGAACCATTGTTTCAAGAGGAGG - Intronic
920214688 1:204353742-204353764 AAAAGCATTGGGTTAGGAGGAGG + Intronic
920333179 1:205227105-205227127 AAATCCATTGTGTCCACAGGAGG + Intergenic
920526754 1:206672804-206672826 AAACTCATTTTTTCAGGAGGGGG - Intronic
920878292 1:209857849-209857871 AAATCCAGTGTGTCCGGAATTGG + Intergenic
921250778 1:213295885-213295907 CAATTCATTGTGTTAGGAGAGGG + Intergenic
921583392 1:216921700-216921722 AAATTCATTGTATTAGAAGGTGG - Intronic
1064061562 10:12141920-12141942 AAATCCAGTTTGTCAGTAGAGGG + Intronic
1069060502 10:63889535-63889557 CAATCCAGTGTGTCAGAGGGCGG + Intergenic
1070352905 10:75610679-75610701 AAATACATTGTGTCAGGACTGGG - Intronic
1071301937 10:84262360-84262382 AAATTCATTGTGTCTGCAGGGGG - Intergenic
1073172625 10:101524229-101524251 AAATCCAATGAGTAAAGAGGGGG - Intronic
1073758087 10:106602683-106602705 AGAGCAAATGTGTCAGGAGGAGG - Intronic
1075299462 10:121308745-121308767 AATTCCAGTGTGTGTGGAGGAGG + Intergenic
1076059211 10:127400444-127400466 AAATCCATCCTGGCAGGAGGTGG + Intronic
1082757207 11:57089599-57089621 AAATGCAGTGTGATAGGAGGGGG + Intergenic
1085566835 11:77521535-77521557 AAAAAAAATGTGTCAGGAGGCGG + Intronic
1087490404 11:98819338-98819360 AAATCAATGGTTGCAGGAGGTGG + Intergenic
1087729400 11:101761048-101761070 AAATCCATGGTATCTAGAGGTGG - Intronic
1092199915 12:6574836-6574858 AAATCCAGTAAGTCAGGAGTTGG + Intronic
1093512191 12:19942563-19942585 AAATCCATGGTTCCAGGCGGGGG + Intergenic
1095535969 12:43247943-43247965 AAATGCATTGTTTCAGTAGGTGG - Intergenic
1095729955 12:45495457-45495479 AAATCCTTTGTGTCAGACTGAGG - Intergenic
1095991544 12:48037859-48037881 GAATCCAGTGTGCCAGGCGGTGG - Intergenic
1097792421 12:63829007-63829029 AATGCAATAGTGTCAGGAGGTGG + Intergenic
1097989290 12:65818174-65818196 AATTCCAAGGTGGCAGGAGGAGG + Intergenic
1100113005 12:91268635-91268657 AAATCCATTCTTGCAGGAGTAGG + Intergenic
1100258462 12:92908276-92908298 AAATTCATAGTGACAGGAAGTGG + Intronic
1101259060 12:103010692-103010714 AAAGCCAGTGTGTGAGGATGAGG - Intergenic
1103442853 12:120976464-120976486 AAATCCATAGAGACAGGAAGTGG - Intergenic
1105024850 12:132841146-132841168 AAAAACATTGTTTCAGGAGAAGG - Exonic
1106721882 13:32443164-32443186 GAATCCATAGTTTCAGGTGGAGG + Exonic
1107215064 13:37907066-37907088 AAATCCATTATGTCAGCAAAAGG + Intergenic
1108351805 13:49594833-49594855 GAATCCATTGTGCCAGGACTAGG - Intergenic
1108362763 13:49682760-49682782 AAATCCTTTCTGTAATGAGGAGG - Intronic
1108551499 13:51550083-51550105 AAATTCATGATGGCAGGAGGTGG - Intergenic
1108575212 13:51784480-51784502 AAATACATTTGGACAGGAGGTGG + Intronic
1108719896 13:53120424-53120446 AAACTCATTTTGTCAGGAAGTGG + Intergenic
1109279659 13:60341413-60341435 AATTCCGTTGTGTAAGGATGTGG - Intergenic
1112873594 13:104006660-104006682 GACTCTATTGTTTCAGGAGGCGG - Intergenic
1117609799 14:57470862-57470884 AAAGCAATTGTCTCAAGAGGAGG - Intronic
1119696376 14:76716614-76716636 AAATACATTCTGTCCCGAGGTGG + Intergenic
1123129817 14:105975880-105975902 AATTCCATAGTGTCCAGAGGTGG + Intergenic
1123200849 14:106662532-106662554 CAATTCATTATGTCATGAGGGGG - Intergenic
1123896760 15:24837809-24837831 AAATCCCTTGAACCAGGAGGCGG - Intronic
1124843081 15:33263101-33263123 ACATACATGGTGGCAGGAGGGGG - Intergenic
1125673536 15:41490234-41490256 AAATCGCTTGTGCCAGCAGGTGG + Intergenic
1128417855 15:67463501-67463523 AAATCCACTGAGTTAGGAAGTGG - Intronic
1130131775 15:81149577-81149599 AGACCCACTGTGTTAGGAGGTGG + Intergenic
1131557300 15:93411045-93411067 AAGTCCATTTTGTCTGTAGGCGG + Intergenic
1131560219 15:93433163-93433185 AAAGCGATGGTATCAGGAGGGGG - Intergenic
1132686956 16:1166226-1166248 AAATCCTTTGCGTCCGGAGTGGG + Intronic
1134000761 16:10781029-10781051 AAACCCATTGTTTCAAGAAGAGG + Intronic
1134133095 16:11663028-11663050 AGATCGCTTGAGTCAGGAGGTGG + Intergenic
1134295685 16:12943521-12943543 AAATCCTTTGTGAAATGAGGTGG + Intronic
1134886597 16:17798634-17798656 AAATACATTCTTCCAGGAGGGGG + Intergenic
1136016507 16:27404254-27404276 AAAGCCCTTGTGATAGGAGGAGG + Intronic
1136649799 16:31659252-31659274 AAATCCCTTGTGATAGGAGGAGG - Intergenic
1137414014 16:48255642-48255664 AATTCCCATGTGTCAGGGGGCGG + Intronic
1138169009 16:54831061-54831083 AACTCCATTGTGTCTGGAATTGG - Intergenic
1138746634 16:59370264-59370286 AAAATGACTGTGTCAGGAGGGGG - Intergenic
1139242059 16:65403172-65403194 AAATCCTTTGTGGGAGAAGGTGG + Intergenic
1141499508 16:84434018-84434040 AAAGCCACTGAGTCAGAAGGTGG + Intronic
1141884357 16:86881536-86881558 AAACCCATAGAGACAGGAGGTGG + Intergenic
1142328497 16:89434207-89434229 GAATCCATAGTGTCTTGAGGAGG - Intronic
1142510867 17:392158-392180 AAATCCATGGAGACAGAAGGCGG - Intergenic
1147864399 17:43543215-43543237 AAATCCAGTGGGTGGGGAGGTGG - Intronic
1148637097 17:49157127-49157149 AACTCCATGGTGACAGGTGGTGG - Intronic
1149714224 17:58771740-58771762 AAATCCATTCTGTAATGAGGTGG - Intronic
1152610596 17:81313433-81313455 ACATTCACTGTTTCAGGAGGTGG + Exonic
1153239157 18:3014954-3014976 AAATCCATTGAATACGGAGGGGG - Intergenic
1153904194 18:9646598-9646620 AACTCCAGTGTGTTAGGAGCAGG + Intergenic
1154309467 18:13255846-13255868 AATTCCATTTTATCAGGATGAGG + Intronic
1155893191 18:31291720-31291742 AAATCTATTTTGTCAGAAAGTGG + Intergenic
1155914788 18:31546153-31546175 GAAGCCATTGGGTCAGGAAGAGG - Exonic
1156847643 18:41686990-41687012 AAATCCATAGGGATAGGAGGAGG + Intergenic
1156956025 18:42964499-42964521 ATAGGCATTGTGTCAGGTGGGGG - Intronic
1159741111 18:72171916-72171938 ACATCCAATGTGACAGGAGTTGG - Intergenic
1159769002 18:72526811-72526833 AAATCCCATGTGTCATGAGAGGG + Intergenic
1160742929 19:695578-695600 AAATCGATGGTCTCAGGTGGTGG + Intergenic
1161292847 19:3504812-3504834 AAATCCATAGAGACAGGAAGTGG - Intergenic
1164519777 19:28970042-28970064 AACTCAACAGTGTCAGGAGGTGG + Intergenic
1166063176 19:40340331-40340353 AAATCTATTTTGTTAGAAGGTGG - Intronic
1168454437 19:56495423-56495445 AAATCCAGTTTGTCAGTAGAAGG - Intergenic
1168636001 19:57997538-57997560 AAATCCAGAGTGTGGGGAGGGGG + Intronic
929026832 2:37612859-37612881 AAATCCAGTTTGTCAGGTGAGGG - Intergenic
929242364 2:39665913-39665935 AAGTGCATTGTGTCTGGCGGCGG + Exonic
929750634 2:44709184-44709206 AAATCCATTTTCTTGGGAGGGGG - Intronic
929753798 2:44746054-44746076 AAATCCTCAGTGTCAGGAAGAGG + Intronic
930634312 2:53787403-53787425 GAACCCTTAGTGTCAGGAGGAGG - Intronic
932238157 2:70137620-70137642 AAAGACATTGTGGCAGGAGAGGG - Intergenic
936018714 2:108978790-108978812 AAATCCATTCTGAAAGCAGGAGG + Intronic
940129691 2:150366946-150366968 AAATCCAATAGGTCAGGAGTAGG + Intergenic
941992644 2:171572099-171572121 AAATCCAGTGTGTCAGTAAAGGG + Intergenic
942318979 2:174719171-174719193 AAATCCACAGTAGCAGGAGGAGG - Intergenic
943603987 2:189954255-189954277 GAATCTATTGTGTAAGGATGTGG - Intronic
944053431 2:195497356-195497378 AATTCAATGGTGTTAGGAGGTGG - Intergenic
945281330 2:208038120-208038142 AAATCCAGTTTGTCAGTAGAGGG - Intergenic
946991813 2:225340119-225340141 AAAACCATTGTGAAAGGAGCAGG + Intergenic
1169243464 20:4005080-4005102 ACATCCACTGTGACAGGTGGTGG + Intronic
1171516198 20:25739628-25739650 AAATCCAGTTTGTCAGTAGAGGG + Intergenic
1177563867 21:22793794-22793816 TAATCCAGTGTGCTAGGAGGTGG + Intergenic
1181020767 22:20101035-20101057 AAATCAAATGTGTCAGTAGAGGG - Intronic
1181901924 22:26163212-26163234 ACAGCCTCTGTGTCAGGAGGAGG - Intergenic
1184557713 22:45241932-45241954 GTATCCAATGTGTCGGGAGGAGG - Intergenic
951232098 3:20191207-20191229 AAAGCCAAGGTGTCAGCAGGTGG - Intergenic
952561500 3:34599065-34599087 AAACCCATTGTGTCAGACAGCGG - Intergenic
955216190 3:56986591-56986613 AAATCGAGTGTTCCAGGAGGAGG + Intronic
955426308 3:58795075-58795097 ACCTCCATTCTGTCTGGAGGTGG - Intronic
957793186 3:84965233-84965255 AAATTCCTTGTGTAAAGAGGTGG + Intronic
958254642 3:91311389-91311411 AAAGCCATTATCTCAGGAGTAGG + Intergenic
958452580 3:94292657-94292679 AAATACATGGTGTCAGAAGTGGG + Intergenic
960147091 3:114215104-114215126 AAATACCTTAGGTCAGGAGGTGG + Intergenic
963450292 3:145471957-145471979 AAGTTTATGGTGTCAGGAGGAGG - Intergenic
966112836 3:176424398-176424420 AAATCCATAGTCTGAGGCGGAGG + Intergenic
967197638 3:187042590-187042612 AAACCCAATGTGGCATGAGGCGG - Intronic
967381438 3:188863523-188863545 AAACTCACAGTGTCAGGAGGAGG - Intronic
967870723 3:194226778-194226800 AAAGCAATGGTGTTAGGAGGTGG + Intergenic
969651384 4:8470167-8470189 AAATCCATTCTGAGAGGAGCGGG - Intronic
970446183 4:16124918-16124940 AAATCCATAGAGGCAGAAGGCGG - Intergenic
972226753 4:37022085-37022107 AAAGCCATAGTGAAAGGAGGAGG + Intergenic
972391226 4:38615622-38615644 ATATCCCTAGTGTCAGGATGTGG - Intergenic
973828210 4:54731044-54731066 AAATTCATTGTGTCAAGAGACGG + Intronic
975613157 4:76221147-76221169 AAACCCATTGTGGCAGGGGAAGG + Intronic
976802750 4:89010933-89010955 AAATCGCTTGAGCCAGGAGGTGG - Intronic
976895651 4:90107779-90107801 ATATCCATTGTGTTAGTATGGGG + Intergenic
977081545 4:92535697-92535719 AAATCTATTGTGTCTGGAACTGG + Intronic
977676677 4:99756076-99756098 AAATCCATTGTGCCAGGCAGAGG + Intergenic
979724501 4:123943764-123943786 TAAGCCATTGTGTCAAGAGGAGG + Intergenic
981856329 4:149297183-149297205 AAGACCATGGTGTCAGAAGGAGG + Intergenic
984009180 4:174349841-174349863 AAATCTTTTGTGTAAAGAGGTGG - Intergenic
985038911 4:185868815-185868837 AAATCCCTTGTCTCAGGCAGTGG + Intronic
985291733 4:188394271-188394293 AAATCCATTGAGTAGGGATGGGG + Intergenic
986579561 5:9251058-9251080 AATGCCATTGTCTCAGGAGTGGG + Intronic
990938733 5:61178358-61178380 GATTACATTGTGTCATGAGGTGG + Intergenic
993955593 5:94228604-94228626 AACTCCATTGTGTCTAGATGTGG - Intronic
995850061 5:116535413-116535435 AAATGCATGGTGGCATGAGGAGG + Intronic
998173313 5:139885136-139885158 AAAGCCATTGTGTCTGGATATGG + Intronic
999361841 5:150992286-150992308 AAATTCCTTGTGGAAGGAGGTGG + Intergenic
1001157056 5:169281691-169281713 ACATCCATTGTTTCAGGTGGGGG - Intronic
1001789837 5:174446538-174446560 AAAATCAATGTGTCAGCAGGGGG - Intergenic
1003485137 6:6569061-6569083 AAGACCAGTGTGTCAGGTGGGGG + Intergenic
1004447794 6:15716705-15716727 AAATCCTGTGTGTCAGAAGGTGG + Intergenic
1009189181 6:60609112-60609134 AAAGCCATTATCTCAGGAGTAGG - Intergenic
1009710742 6:67315337-67315359 TAATTCATTGTGTCTGAAGGAGG + Intergenic
1011762355 6:90581490-90581512 AAATCCATCTTGTCAGCAGATGG - Intronic
1012686764 6:102260153-102260175 AAATCCATTGACTAAAGAGGTGG - Intergenic
1013414120 6:109909405-109909427 AAATCCATAGTATTAAGAGGTGG + Intergenic
1013601239 6:111707133-111707155 AGACCCAAGGTGTCAGGAGGAGG + Intronic
1016394941 6:143613841-143613863 AAATTCTTTGTGTGTGGAGGTGG - Intronic
1017175060 6:151494558-151494580 AAATCTGATGTGGCAGGAGGAGG + Intronic
1018900934 6:168051414-168051436 AAGGCCATGGTGTTAGGAGGGGG + Intergenic
1018998169 6:168725889-168725911 AAAGCCACAGTGTCACGAGGAGG + Intergenic
1021989557 7:26128931-26128953 AAATGAATGGTGTCAGGAGGGGG + Intergenic
1022486182 7:30779641-30779663 AATTCCCTTCTCTCAGGAGGGGG + Intronic
1023947055 7:44811495-44811517 AAGTCCATAGTGACAGGAGGAGG - Intronic
1026724149 7:72857445-72857467 AAATCACTTGAATCAGGAGGCGG + Intergenic
1031157970 7:118133580-118133602 AAATCCTTTGTGGTAGGAGTAGG - Intergenic
1031180681 7:118411070-118411092 AAATCAAATGTGTCAGGAAGTGG + Intergenic
1032751576 7:134846740-134846762 AAAACAATTGGGTGAGGAGGGGG - Intronic
1034159365 7:148981798-148981820 AAATCGCTTGCGCCAGGAGGTGG - Intergenic
1035659023 8:1333054-1333076 AAAGCGATGGTGTCTGGAGGAGG + Intergenic
1035757263 8:2043562-2043584 AAAACGATGGTGTGAGGAGGTGG + Intergenic
1036134362 8:6146088-6146110 AAATCCACACTGTCAGCAGGTGG + Intergenic
1037106703 8:15117459-15117481 AAATCCATTGTGGCATGATGGGG + Intronic
1038512176 8:28148902-28148924 AAATCCATACCATCAGGAGGTGG + Intronic
1039447976 8:37647883-37647905 ATCTCCATTCTGTCAGGAAGGGG + Intergenic
1041714260 8:60919914-60919936 AAAGCCATTGTAGTAGGAGGTGG - Intergenic
1042740478 8:72038696-72038718 AAATCCTTTGTGGAAGGAGAGGG - Intronic
1044222813 8:89689300-89689322 AAATACATTGTGTCAGAGAGAGG - Intergenic
1045339238 8:101237292-101237314 AAATCCATAGAGGCAGAAGGTGG - Intergenic
1047057196 8:121178987-121179009 ATAATCATTGTGTCAGGATGGGG - Intergenic
1048729000 8:137417088-137417110 AAATACATTGTGTCTGAAGTTGG - Intergenic
1049496621 8:142938632-142938654 AAATCACTTGAGCCAGGAGGTGG + Intergenic
1051562383 9:18456335-18456357 ATTTCCAGTGTGGCAGGAGGAGG - Intergenic
1056488760 9:87084769-87084791 ACCTCCAAAGTGTCAGGAGGAGG - Intergenic
1056664673 9:88572086-88572108 AGATGCATTCTGTCTGGAGGTGG - Intronic
1058556967 9:106179456-106179478 AAATTCATTTTGAGAGGAGGCGG + Intergenic
1059871489 9:118583078-118583100 GAATCCATTGTGTCAATAGGTGG - Intergenic
1060719458 9:125965692-125965714 AAACCCACTGTGGCAGGAGTTGG - Intronic
1185731139 X:2462916-2462938 AAGACAATGGTGTCAGGAGGTGG + Intronic
1187697331 X:21935495-21935517 AAATCCATAGAGACAGGAAGCGG - Intergenic
1188028626 X:25238503-25238525 AAGTCCATTGTGGCTGGAAGGGG + Intergenic
1188240171 X:27776867-27776889 CAATTCATTGTTTCAGGAGAGGG - Intergenic
1189074125 X:37897946-37897968 AAATCAACTGTGTGTGGAGGTGG + Intronic
1189434125 X:40976019-40976041 AATTTCAATGTGTCAGGAAGAGG + Intergenic
1190558900 X:51668131-51668153 TAATCCATTGTGTGAAGATGGGG + Intergenic
1190565391 X:51725191-51725213 TAATCCATTGTGTGAAGATGGGG - Intergenic
1191674640 X:63782082-63782104 ATATACACTATGTCAGGAGGTGG - Intronic
1193777286 X:85658235-85658257 AATTCCCATGTGTCAGGAGAGGG + Intergenic
1195877889 X:109561449-109561471 ATCTCCAATGTGTTAGGAGGTGG + Intergenic
1196095191 X:111791294-111791316 GAATCCATTGTGCCAGGACTAGG - Intronic
1199841223 X:151651407-151651429 AAATCCATTGTGTCAGGAGGTGG + Intronic
1200167007 X:154043135-154043157 AAATCCATAGAGACAGGAAGTGG + Intronic
1201866753 Y:18664112-18664134 AAATCCATGGTGTCAGGTCCTGG + Intergenic
1202356400 Y:24054635-24054657 GAATCCATGGAGTCAGAAGGTGG - Intergenic
1202514378 Y:25615474-25615496 GAATCCATGGAGTCAGAAGGTGG + Intergenic