ID: 1199844226

View in Genome Browser
Species Human (GRCh38)
Location X:151679095-151679117
Sequence CTGTGGGTCTGGGGGCACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199844217_1199844226 -5 Left 1199844217 X:151679077-151679099 CCTGGGACTACAACTTTCCTGTG No data
Right 1199844226 X:151679095-151679117 CTGTGGGTCTGGGGGCACAAGGG No data
1199844212_1199844226 20 Left 1199844212 X:151679052-151679074 CCTGCAGTGGGGGTGCAGTTCTG No data
Right 1199844226 X:151679095-151679117 CTGTGGGTCTGGGGGCACAAGGG No data
1199844216_1199844226 -4 Left 1199844216 X:151679076-151679098 CCCTGGGACTACAACTTTCCTGT No data
Right 1199844226 X:151679095-151679117 CTGTGGGTCTGGGGGCACAAGGG No data
1199844211_1199844226 21 Left 1199844211 X:151679051-151679073 CCCTGCAGTGGGGGTGCAGTTCT No data
Right 1199844226 X:151679095-151679117 CTGTGGGTCTGGGGGCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199844226 Original CRISPR CTGTGGGTCTGGGGGCACAA GGG Intergenic
No off target data available for this crispr