ID: 1199847915

View in Genome Browser
Species Human (GRCh38)
Location X:151704443-151704465
Sequence GATGCTCCACCCACTGGGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199847915 Original CRISPR GATGCTCCACCCACTGGGAG AGG (reversed) Exonic
900478194 1:2885966-2885988 AACGCTCCACACAGTGGGAGGGG + Intergenic
900587462 1:3440075-3440097 GAGGCCCGGCCCACTGGGAGGGG - Intergenic
900620359 1:3584240-3584262 TGAGCTCCAGCCACTGGGAGAGG - Intronic
903756546 1:25665889-25665911 GCTGCTCCAGCCATGGGGAGAGG + Intronic
904963713 1:34355330-34355352 GAAGCACCACCCAGTGGGACTGG - Intergenic
905942304 1:41873858-41873880 GCTTCTCCACCTTCTGGGAGAGG - Intronic
906524141 1:46484859-46484881 AATGCTCCTCCCACCTGGAGAGG - Intergenic
907432813 1:54423733-54423755 CATGAGCCACCCGCTGGGAGGGG - Intergenic
908521374 1:64946168-64946190 GATGCTCCTCCTACTGTGGGTGG - Intronic
909342243 1:74545192-74545214 GATGCTACTCACACTGGGAAGGG - Intergenic
910724860 1:90327929-90327951 GAGGTTCCAACCACTGGGATGGG - Intergenic
910945409 1:92586301-92586323 GATACTCCACCCTCAAGGAGGGG - Intronic
911672140 1:100619440-100619462 GAAGCTCAAGCCACTTGGAGAGG + Intergenic
912419124 1:109531557-109531579 GAACCTCCACCCACAGAGAGTGG - Intergenic
913077829 1:115356269-115356291 GATGCTCCACCCACAGGCTCAGG + Intergenic
914790904 1:150876599-150876621 GCGGCTCCTCCCACTGGGGGGGG - Exonic
914905479 1:151740185-151740207 CATGCTCCACCTACTGCCAGTGG - Intergenic
918764721 1:188465224-188465246 GATCCAACACCCACTGGCAGAGG - Intergenic
919792336 1:201300221-201300243 CATGCTCCTTCCACAGGGAGGGG - Intronic
924095332 1:240545161-240545183 CATCCTCCAACCACTGGGAAAGG + Intronic
1062791110 10:307327-307349 GGTGCTGCAGCCACTGGCAGGGG - Intronic
1063607977 10:7539683-7539705 GTTGCTCCAAAAACTGGGAGTGG + Intergenic
1064028684 10:11869629-11869651 GGTGCTCCACCGGCGGGGAGGGG - Exonic
1065266248 10:23979314-23979336 GATCTTCCACTCACTGGGACTGG - Intronic
1067960597 10:50844058-50844080 GATGCTGCACCCCCTGAAAGGGG - Exonic
1069127101 10:64649534-64649556 AAAGCTCCACCCACTGGGGATGG + Intergenic
1069334467 10:67331503-67331525 GATTCTCCTCCAACTGGGGGAGG + Intronic
1073478849 10:103772777-103772799 GGAGCTCCACCCTCTGGGAGGGG - Intronic
1074163555 10:110855134-110855156 GATGCCACACCCACTGTGGGAGG - Intergenic
1076520599 10:131078526-131078548 GATTCTTCTCCCACTGGGAAGGG - Intergenic
1077315154 11:1916436-1916458 GATGCCCCAGCCACTGAGAGAGG + Intergenic
1077442679 11:2575952-2575974 GAGTCTCCAGCCACGGGGAGAGG - Intronic
1078102588 11:8338536-8338558 GTGGTTCCACCCTCTGGGAGTGG - Intergenic
1079533648 11:21485375-21485397 TATTCTCCTCCCACTGAGAGTGG + Intronic
1081989183 11:47328525-47328547 GCTGCTGCAGCCACTGTGAGAGG + Intronic
1083485804 11:62982363-62982385 GATGCTCTGGCCACTGAGAGTGG - Intronic
1094054573 12:26256121-26256143 GAAGCCCCACCCACTGAGAAAGG - Intronic
1095574591 12:43721731-43721753 GATGTTCCAGCCAATGGGAATGG + Intergenic
1096828158 12:54295003-54295025 AATGCTCCAGGCACTGGGAAAGG - Intronic
1098041648 12:66359054-66359076 GATGCCCCACCCTCTAGGAATGG - Intronic
1100706171 12:97202785-97202807 GATGCTCCACCTCTGGGGAGTGG + Intergenic
1100825518 12:98471256-98471278 GATGCTCCTCCCACTTAGATAGG + Intergenic
1101672147 12:106885508-106885530 TATGCTCCAACCACTGGGGCAGG + Intronic
1102766618 12:115439219-115439241 GTCCCTCCACCCACTGGGAGAGG + Intergenic
1103451998 12:121035778-121035800 GCACCTCCACCCCCTGGGAGAGG + Intronic
1105073593 12:133253873-133253895 GATGCTCCAACCCCAGGGAGGGG + Intergenic
1105421706 13:20258257-20258279 GAAGCTTCTCCCAGTGGGAGTGG + Intergenic
1108434942 13:50392637-50392659 GGGGCTCCACCCACTCAGAGTGG - Intronic
1113482935 13:110634899-110634921 GACGCGCCATCCGCTGGGAGAGG - Intronic
1114630615 14:24157280-24157302 GCTGCTCCTCCCACTGCCAGAGG - Exonic
1118547523 14:66908530-66908552 GATGCTCCACCCTCAAGGAAGGG + Intronic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1122245583 14:100401208-100401230 GAGGCTGCAGCCACGGGGAGGGG - Intronic
1122830432 14:104393133-104393155 GTCGCTGCACCCACTGGCAGTGG + Intergenic
1122831386 14:104398821-104398843 GTGGCTGCACCCACAGGGAGAGG - Intergenic
1128712723 15:69884304-69884326 GATGCTCTGAGCACTGGGAGGGG + Intergenic
1130131150 15:81143812-81143834 GATGCTGCACTCACCGGGACGGG - Exonic
1130192403 15:81749725-81749747 GATTCTGCACCCACAGGCAGAGG + Intergenic
1132632671 16:927395-927417 GATGCTTCTCCCCCAGGGAGGGG + Intronic
1133543943 16:6786764-6786786 GAAACTCCACCCAATGGAAGTGG + Intronic
1136379929 16:29888509-29888531 GATGCCCCACCCACTGTGGCAGG + Intronic
1139374269 16:66487046-66487068 GATCCACTGCCCACTGGGAGGGG + Intronic
1139551082 16:67673431-67673453 GAGGCTCCTGCCACAGGGAGGGG + Intergenic
1141710466 16:85695981-85696003 GATGCTGCACTCAGCGGGAGAGG - Intronic
1142699122 17:1649032-1649054 GCTGCTCCTGCAACTGGGAGCGG + Exonic
1143658838 17:8312595-8312617 GAAGCTCCCCTCACCGGGAGTGG + Exonic
1147850518 17:43439099-43439121 GATGGTCCACCCCCAGGGATGGG + Intergenic
1148350178 17:46935768-46935790 GAGACTCCAGCCCCTGGGAGTGG + Intronic
1151548462 17:74807553-74807575 GATGACCCGCCCACTGGGAAAGG - Intronic
1153499508 18:5733603-5733625 TATTCTTCACTCACTGGGAGAGG - Intergenic
1157804996 18:50651261-50651283 GAGGCTCCACCGACTGGGTGCGG - Intronic
1161431220 19:4233445-4233467 GGTGCTCCACGTACTGGTAGAGG - Intronic
925428462 2:3770914-3770936 GATGCTCCACCCACCAGCCGTGG + Intronic
925854521 2:8116867-8116889 TATGCTCCTCCCACTGGGCTGGG + Intergenic
925878074 2:8328784-8328806 GGTGCTCCACCCACAGGGGTGGG - Intergenic
930439767 2:51391092-51391114 CATGTTCCAACCACTGGGATGGG + Intergenic
931800545 2:65753864-65753886 GATCCTCTACATACTGGGAGAGG - Intergenic
937358080 2:121211023-121211045 GGAGCTCCTCCCAGTGGGAGAGG + Intergenic
937895818 2:126976252-126976274 GCTGCTCCACCTCCTGGGATTGG + Intergenic
941612246 2:167676140-167676162 GGTGCTGCAGCCTCTGGGAGAGG - Intergenic
943649501 2:190441768-190441790 TATGCCCCACCCACTGTGGGTGG + Intronic
943743546 2:191437471-191437493 GATGCTCCACACGGTAGGAGTGG + Intergenic
946157638 2:217817739-217817761 GGTGCTGCCCCCACTGGGACTGG + Exonic
1172138000 20:32700696-32700718 TATGCTACAGCCACAGGGAGGGG + Intergenic
1176363300 21:6016694-6016716 GCTGCTTCACCCCCTGGCAGAGG + Intergenic
1177701171 21:24641239-24641261 GATGATTCACCCACTCCGAGTGG + Intergenic
1178662492 21:34519297-34519319 CCTGCTCCACCCACAGGGTGTGG + Intronic
1179405088 21:41119099-41119121 CATGCTCCACTCACTGGGGTGGG + Intergenic
1179760218 21:43521851-43521873 GCTGCTTCACCCCCTGGCAGAGG - Intergenic
950291367 3:11787094-11787116 GGTGCCCAAGCCACTGGGAGAGG - Intergenic
950495276 3:13330128-13330150 GGTGCTCCACCCACTGTGCCTGG - Intronic
952970985 3:38649839-38649861 GGTGCTCCGCCCGCTCGGAGGGG + Intergenic
954414231 3:50385136-50385158 GATGCTGCAGCCGATGGGAGGGG + Intronic
954655688 3:52192797-52192819 GATCCTCTACCCACTGTGTGCGG + Intergenic
959941512 3:112086313-112086335 CACACTCCACCCACTGGGCGGGG - Exonic
961621489 3:128228205-128228227 GCAGCTTCACCCACTGGGACAGG - Intronic
962875592 3:139533865-139533887 GAGGCTCCAGCCACAGGGGGAGG + Intronic
963725161 3:148911756-148911778 TATGCTCCACCCACAGTGGGAGG - Intergenic
964179237 3:153864420-153864442 GAAGCTCTAACCACTGGGATGGG - Intergenic
965975415 3:174614360-174614382 GAAGTTCCAACCACTGGGATGGG + Intronic
967792224 3:193561661-193561683 GATGCCACACTAACTGGGAGAGG - Intronic
968168238 3:196486452-196486474 GGAGCTCCACCTGCTGGGAGGGG - Intronic
968506307 4:972891-972913 GCTGCCCCAGCCACTGGGAGAGG + Intronic
972385556 4:38562306-38562328 GATGCTATACCAAGTGGGAGGGG + Intergenic
973144914 4:46813094-46813116 AATGCACCACCAACTGGGATGGG + Intronic
976129308 4:81867789-81867811 GATGCTCCACCCTATGGGAGGGG + Intronic
979323665 4:119353611-119353633 GAGGCTCCACCCTCAGTGAGAGG - Intergenic
983241495 4:165238277-165238299 GAGGCTCCACCCTCAGTGAGAGG - Intronic
987378217 5:17257910-17257932 GATGCTCCTGTCACTGGCAGGGG - Intronic
987834685 5:23146159-23146181 GATGCCCCACCCACTGAGGAAGG + Intergenic
988059517 5:26148978-26149000 GATGCCCCACCCACTGAGGAAGG - Intergenic
990673282 5:58156538-58156560 GATGTTCCAGCCACAGCGAGAGG - Intergenic
991507751 5:67342921-67342943 GATGTTGCAGCCACTGGGACTGG - Intergenic
992191155 5:74293360-74293382 AGTGCTCCAACCACTGGGAAAGG + Intergenic
998401006 5:141849208-141849230 GTTGCCACACCCACTGGTAGGGG + Intergenic
999200498 5:149812889-149812911 GGGCTTCCACCCACTGGGAGGGG + Intronic
1000423198 5:161060740-161060762 GATGCTTCTGCCACTGGGATGGG + Intergenic
1002803678 6:551558-551580 TGTGCTCCACCCACTGGAAGAGG + Intronic
1004416845 6:15432488-15432510 TACGCTCCACAGACTGGGAGTGG + Intronic
1006392520 6:33766779-33766801 GAAGCTCCACCCAGGGGCAGGGG - Intergenic
1007339037 6:41178406-41178428 GATGGGCCACCGACAGGGAGAGG - Intergenic
1009305459 6:62083667-62083689 CATGCTCCACCTCCTGTGAGGGG + Intronic
1012213527 6:96554372-96554394 GATGCTCCTACCACTGGAAAAGG - Exonic
1014217545 6:118767299-118767321 GCAGCTCCAACCACTGGCAGGGG - Intergenic
1014225617 6:118843123-118843145 GATGCTTAAGCAACTGGGAGAGG - Intronic
1018626915 6:165788908-165788930 GATGGTGCACACACTGGGGGTGG - Intronic
1020009005 7:4798488-4798510 GCAGCTCCACCAACTGGGTGTGG - Intronic
1020283586 7:6663912-6663934 GAGGCTCCACCCACATGGGGCGG - Intergenic
1020415202 7:7937690-7937712 GATGAGCCACAAACTGGGAGAGG + Intronic
1022501465 7:30884648-30884670 GGTGGGCCACCCCCTGGGAGGGG - Intronic
1027443550 7:78246067-78246089 GATGCAGCAACCACTGGGAGGGG - Intronic
1028946821 7:96589288-96589310 GGTACTCAACCCACTGGGAGTGG + Intronic
1029655013 7:101918521-101918543 CACCCTCCACCCACTGGCAGTGG - Intronic
1035165314 7:156985849-156985871 GATGCTCCAGCCGCTGGGCCTGG - Intergenic
1035494160 7:159307299-159307321 GATGCTCCAACCCCACGGAGGGG + Intergenic
1035726985 8:1830923-1830945 GCTGTTCCTCCCACTGGGAATGG - Intronic
1036155334 8:6336769-6336791 GATGAACTATCCACTGGGAGTGG - Intergenic
1040332987 8:46401728-46401750 GGTGCTCCCCCCTCTGGGTGGGG - Intergenic
1043864643 8:85361124-85361146 GAGGCTCAGGCCACTGGGAGGGG + Intronic
1044310200 8:90684577-90684599 TATGCTCCATCCACTGAGATAGG + Intronic
1044310332 8:90685424-90685446 TATGCTCCATCCACTGAGATAGG + Intronic
1045826506 8:106404152-106404174 GATGCTGCTACCACTGGGTGTGG + Intronic
1048574811 8:135682174-135682196 GATGCTCCAGCCACTGACTGCGG - Intergenic
1050944441 9:11499668-11499690 GCTGCTCCACCCATTGTGGGAGG - Intergenic
1056570376 9:87809590-87809612 TATGCTCCACGGAGTGGGAGTGG - Intergenic
1057523920 9:95783419-95783441 GATGATTCACCCACTGGGGCTGG - Intergenic
1057596010 9:96417243-96417265 GTTGTTCCACCGACTGCGAGAGG - Intronic
1061004691 9:127921858-127921880 GCGCCTCCACCCACTGGCAGAGG + Exonic
1061231047 9:129315966-129315988 CAGGCTACACACACTGGGAGAGG - Intergenic
1062706488 9:137946998-137947020 TATGCTCCACAGAGTGGGAGTGG + Intronic
1186604925 X:11079498-11079520 GATGCTCCCCTCACTAGGACTGG + Intergenic
1189372207 X:40437762-40437784 GATGCTGCTCCCACTGGGCTTGG - Intergenic
1191019244 X:55842200-55842222 GAGGCTCCACCCAATGAGAAAGG + Intergenic
1192760200 X:74088448-74088470 GATGGAGCACCCACAGGGAGAGG + Intergenic
1194457681 X:94124431-94124453 CATGTTCCAACCACTGGGATTGG + Intergenic
1195104879 X:101594012-101594034 GATGGAGCACCCACGGGGAGGGG - Intergenic
1197035531 X:121869955-121869977 CATGCCCCACCCACTTGGAAGGG - Intergenic
1199847915 X:151704443-151704465 GATGCTCCACCCACTGGGAGAGG - Exonic
1200231986 X:154448680-154448702 GATTCTCCTCCTCCTGGGAGAGG - Exonic