ID: 1199849024

View in Genome Browser
Species Human (GRCh38)
Location X:151712058-151712080
Sequence CCAGGTGCACCCATTTGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199849017_1199849024 28 Left 1199849017 X:151712007-151712029 CCATAAGGTTCATTAACAAGCCA No data
Right 1199849024 X:151712058-151712080 CCAGGTGCACCCATTTGCTTGGG No data
1199849019_1199849024 8 Left 1199849019 X:151712027-151712049 CCAAGAGGAAGCTCTCAGCTGCC No data
Right 1199849024 X:151712058-151712080 CCAGGTGCACCCATTTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199849024 Original CRISPR CCAGGTGCACCCATTTGCTT GGG Intergenic
No off target data available for this crispr