ID: 1199850391

View in Genome Browser
Species Human (GRCh38)
Location X:151721741-151721763
Sequence AAGAGGGCCTAGGGCCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199850391_1199850396 -9 Left 1199850391 X:151721741-151721763 CCCTCAAGGCCCTAGGCCCTCTT 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1199850396 X:151721755-151721777 GGCCCTCTTTACCATGGAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 116
1199850391_1199850400 -1 Left 1199850391 X:151721741-151721763 CCCTCAAGGCCCTAGGCCCTCTT 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1199850400 X:151721763-151721785 TTACCATGGAAGAGGACTGGAGG 0: 1
1: 0
2: 1
3: 15
4: 200
1199850391_1199850399 -4 Left 1199850391 X:151721741-151721763 CCCTCAAGGCCCTAGGCCCTCTT 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1199850399 X:151721760-151721782 TCTTTACCATGGAAGAGGACTGG 0: 1
1: 0
2: 2
3: 8
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199850391 Original CRISPR AAGAGGGCCTAGGGCCTTGA GGG (reversed) Intronic
900794254 1:4698567-4698589 GAGAGGGCCAATGACCTTGAAGG - Intronic
902124192 1:14194725-14194747 AGGAGGGCATGGGCCCTTGAGGG + Intergenic
902770368 1:18642447-18642469 TAGAGGCTCTGGGGCCTTGAAGG + Intronic
903005771 1:20297643-20297665 AAGAGGGCTAAGATCCTTGAAGG - Intronic
904919433 1:33995398-33995420 AACAGGGCCTAGTGGCTTCAGGG + Intronic
904947868 1:34212585-34212607 AAGAGGGTCTGGGGCCTGGTGGG + Intronic
908771015 1:67595470-67595492 CAGGGGGCTTAGGACCTTGAGGG + Intergenic
910353172 1:86323321-86323343 AGGAGGGCCTGGTTCCTTGAAGG - Intergenic
910653857 1:89600129-89600151 AAGTGGGCCTAGGGGCTGTAGGG + Intergenic
913523689 1:119669955-119669977 AAGAGGGTCTAGAACCTTGAAGG - Intronic
915479081 1:156172952-156172974 GAGACAGCCCAGGGCCTTGATGG + Exonic
915682564 1:157595726-157595748 AAGGGGGCCAAGGCCCTTGCTGG + Intronic
918625758 1:186654308-186654330 TAGAGGGACAAGGGACTTGAAGG + Intergenic
918854863 1:189738939-189738961 CAGAGATCCTATGGCCTTGAAGG + Intergenic
920577496 1:207072316-207072338 GAGAGGGCTGAGGGGCTTGAGGG - Exonic
920677210 1:208046444-208046466 AAGAGGGCCTGGGGCATGGGGGG + Intronic
920697613 1:208193290-208193312 AAGGGGCCCTAGGGCTATGAGGG - Intronic
921355514 1:214281255-214281277 ATGAGGGCCGAGGGCCTCGGCGG + Exonic
921536137 1:216350894-216350916 TAGAGGTTCTAGGGCCATGAGGG + Intronic
923906257 1:238388531-238388553 AAGCAGGACTAGGGCCATGATGG - Intergenic
924216100 1:241824085-241824107 AAGAGGGTCTAGGGCATTCCAGG + Intergenic
924655202 1:245968423-245968445 AGGAGGCACTTGGGCCTTGAAGG - Intronic
924775424 1:247112189-247112211 AGGAGGGCCCAGGGGCTGGAGGG + Exonic
1073248429 10:102107476-102107498 ATGGGGGCCTAGGGCCTAGGTGG - Intergenic
1073886330 10:108044064-108044086 AACAGGGCCTCTGGCCTTGTGGG - Intergenic
1076434477 10:130430682-130430704 GAAAGGGCCTGGGGCCATGATGG - Intergenic
1076638278 10:131897544-131897566 AACAGGGCCTAAGGCCGTGCGGG + Intergenic
1077875306 11:6299922-6299944 CAGAGGGCCTAGAGACTTTAAGG + Intergenic
1081814132 11:45929186-45929208 AGGAGGGCCTGGGCCCTTAAGGG + Intergenic
1083301051 11:61739776-61739798 AAGATGGCCCAGGGCCTCCATGG + Intronic
1084736624 11:71109444-71109466 AAGATGGCCCAGGCCCTTGGTGG - Intronic
1085022264 11:73217303-73217325 AAGAGGGCCCAAGGCCCCGAAGG + Intergenic
1085235224 11:75009453-75009475 AATAGGTCCCAGGGCCCTGAAGG - Exonic
1086993351 11:93330251-93330273 AAGAGGGCCAAGGGGATTTAAGG + Intronic
1089083924 11:115800806-115800828 AAGAGGGCCAAGGGCCAGAAAGG + Intergenic
1089458865 11:118641248-118641270 AAGAGGTCCTTGGGCATTGGTGG - Intronic
1093885535 12:24455769-24455791 AGGAGGGCCTTGGTCCTGGAGGG - Intergenic
1095808163 12:46343735-46343757 AAGAGAGCCTGCTGCCTTGAAGG - Intergenic
1098574554 12:72026501-72026523 AAGAGGCCCAAGGGCCTTGCAGG + Intronic
1099430981 12:82585510-82585532 AGGAGTGTCTGGGGCCTTGATGG - Intergenic
1099524753 12:83705610-83705632 AAGAGAACCTACTGCCTTGAAGG + Intergenic
1100214748 12:92435812-92435834 GAGAGGGCCAAGGGCACTGAGGG - Intergenic
1100871811 12:98917475-98917497 AAGAAGGGCTAGGGCACTGAAGG - Intronic
1103533750 12:121620552-121620574 AAGAGGGCCTGAGGTCTGGAGGG - Intergenic
1103699091 12:122839063-122839085 AAGAGCACCTAGGGCATAGAAGG + Intronic
1106142608 13:27023849-27023871 AATAGGGCCTGGGGCCCAGAAGG + Intergenic
1112471540 13:99694092-99694114 AAGAGGTTCCAGTGCCTTGATGG - Intronic
1117776738 14:59190578-59190600 TAGAGGGCGCAGGTCCTTGAGGG + Intronic
1119719842 14:76883319-76883341 AGGAGGGCCTAGGGCTTTCCGGG + Intergenic
1120072593 14:80120789-80120811 CAGAAGGCCTAGGCCCTTGCCGG + Intergenic
1120074762 14:80142956-80142978 AAGAGGGCATAAGGGCATGATGG + Intergenic
1122386604 14:101352619-101352641 AAGAGGGCTTGGGGCATTGGAGG - Intergenic
1130808617 15:87353371-87353393 AAGAGGACATTGGGCCTAGAGGG - Intergenic
1131057306 15:89383326-89383348 TAGAGAGCCTCGGGCCTTAAGGG + Intergenic
1131259839 15:90882577-90882599 AACAGGGACTTGGGCCCTGACGG - Exonic
1133434413 16:5766802-5766824 TAGAGAGCAGAGGGCCTTGAGGG - Intergenic
1134747638 16:16600468-16600490 CAGAGGGCCTGGGGCCTTTTAGG - Intergenic
1134997829 16:18753191-18753213 CAGAGGGCCTGGGGCCTTTTAGG + Intergenic
1135082347 16:19446940-19446962 AAGAGCACCTAGAGCCTTGGAGG - Intronic
1135637431 16:24090519-24090541 AAGAGGGGCAAGGGAGTTGAGGG + Intronic
1137270606 16:46900256-46900278 GAGGGGGCCTAGGGCGTTGAGGG + Intronic
1137277822 16:46948561-46948583 AAAAGGGGCTTGGGACTTGAAGG - Intergenic
1137604313 16:49776788-49776810 AAGAATGTCTAGGGCCCTGAGGG + Intronic
1137672619 16:50288119-50288141 AGGAGGCCCCAGGGCCTGGAGGG - Exonic
1139593575 16:67946124-67946146 GAGAGGGGCTAGGCCCTTGGAGG - Intronic
1141195546 16:81858091-81858113 AGCAGGTCCTAGGGCCATGACGG + Intronic
1142432609 16:90038120-90038142 CAGAAGGCCTGGGGTCTTGATGG + Intronic
1143732074 17:8886977-8886999 AAGAGGGCCCAGGTCCTCCATGG + Intronic
1148071291 17:44910393-44910415 AAGAGGGACCAGGGCCTAGCAGG + Exonic
1148861021 17:50604410-50604432 AAAAGGGCCTAGAGCCTGGAGGG - Intronic
1149951260 17:60989589-60989611 AAGAGGCCATATGGCCTTGTAGG - Intronic
1150137939 17:62706000-62706022 GAGTGAGCCCAGGGCCTTGATGG - Intronic
1150860332 17:68794894-68794916 ATGAGAGCCTGGGGCCTTGGAGG - Intergenic
1154347603 18:13556292-13556314 AGGAGGCCCTAGGGCCTTGCTGG + Intronic
1154423813 18:14256900-14256922 AAAAGGGGAAAGGGCCTTGAAGG - Intergenic
1155786688 18:29912039-29912061 AAGAGGGCCTGGGGTTTTTATGG - Intergenic
1159730572 18:72022425-72022447 GAGAGCCCCTAGTGCCTTGAGGG + Intergenic
1162158541 19:8696068-8696090 AGGAGGGCCTAGGGTCTAGTGGG + Intergenic
1162951250 19:14073204-14073226 AGGAGGTCTTAGGGCCTGGAGGG - Exonic
1165049521 19:33132556-33132578 AAATGGGCCTAGGGCCTCGCTGG - Intronic
1166001457 19:39879903-39879925 AAGAGGGAGGAGGACCTTGAGGG + Intronic
1166004240 19:39896154-39896176 AAGAGGGAGGAGGACCTTGAGGG + Intronic
925198286 2:1945423-1945445 AGGAGGACCAAGGGCCGTGAGGG + Intronic
925588510 2:5487210-5487232 AAGAGAACCTGGTGCCTTGAAGG + Intergenic
931054170 2:58450018-58450040 AAGAGGCCAGAGGGGCTTGAGGG - Intergenic
931967595 2:67550685-67550707 AGCAGGACCTAGGGCCTAGAAGG + Intergenic
932028719 2:68161328-68161350 AAGAGGACATTGGGCATTGAAGG + Intronic
937045711 2:118850346-118850368 AAGAGGGCGTAGGGTCTGGGTGG - Intergenic
937215210 2:120308423-120308445 GGGAGGCCCTAGGGACTTGAGGG - Intergenic
937955801 2:127421217-127421239 AAGAGGGGCTGGGGCCATGAGGG - Intronic
941413101 2:165185348-165185370 AAGATGGGCAAGGGACTTGAAGG - Intronic
942156344 2:173132524-173132546 AGGAGGGGCTAGGGCTTTGAAGG - Intronic
946225379 2:218261594-218261616 AAGGGGGCATAAGGCCTTGGAGG + Intronic
946335419 2:219032307-219032329 ATGAGGGGCTAAGCCCTTGACGG + Intronic
948186700 2:236026868-236026890 AAGACGGCATAGGGGCTGGAAGG - Intronic
948858686 2:240742662-240742684 AAGAGGGTCGGGGGCTTTGAGGG - Intronic
1169262316 20:4148330-4148352 AAGAGGGCATAGGGATTTGTGGG + Intronic
1170164517 20:13347413-13347435 AAAAGGACCTATGGCCTTCAGGG - Intergenic
1170236008 20:14105875-14105897 AAGAGAACCTGCGGCCTTGAAGG + Intronic
1172495264 20:35377762-35377784 ACTTGGGCCTTGGGCCTTGAAGG - Intronic
1172771929 20:37386962-37386984 GAGAGGGTCAAGGGCCTCGAAGG + Intronic
1173215334 20:41076572-41076594 GAGAAGGCCTAATGCCTTGATGG + Intronic
1175338705 20:58213886-58213908 ACAAGGGCCTTGGGTCTTGAGGG + Intergenic
1175733711 20:61371273-61371295 AAGAGGGCAAATGGCCCTGATGG - Intronic
1180749483 22:18114283-18114305 AAGAGGCCGGAGGGCGTTGAAGG - Intronic
1181103102 22:20554633-20554655 AAGATGGGCTGAGGCCTTGAGGG - Intronic
1181464816 22:23105229-23105251 AAGGGGGCCCAGAGCCTCGAAGG + Intronic
1182556971 22:31134400-31134422 AAGGGGGCCTGGGGCCCTGAGGG + Exonic
1183429223 22:37755669-37755691 AAGCTGGACTGGGGCCTTGAGGG + Intronic
1183936956 22:41268052-41268074 AAGAGGGCCTTGCGCGTGGAGGG + Intronic
952868821 3:37878993-37879015 GAGAGGGCCTAGGGTCTTGAGGG + Intronic
953023854 3:39133611-39133633 AAGAGGGCCTAGAGTTGTGAGGG + Intronic
953096596 3:39782891-39782913 AAGAGTCTGTAGGGCCTTGAGGG - Intergenic
954132549 3:48567854-48567876 AAGGGAGCCTGTGGCCTTGATGG - Exonic
954663781 3:52239596-52239618 AGGCGGGCCTAGGCCCGTGAGGG - Intergenic
957810497 3:85215203-85215225 AAGAGAGCCCACTGCCTTGAAGG - Intronic
960518028 3:118623628-118623650 AAGATGGCCAAGGGACTAGAAGG + Intergenic
961475235 3:127141844-127141866 GAGGAGGCCTGGGGCCTTGAGGG - Intergenic
968028866 3:195465826-195465848 CAGATGGCTTAGGGCCTTGGAGG + Intergenic
969598403 4:8161664-8161686 AATGGGGCCTGGGGCCTTCAAGG - Intergenic
970380842 4:15506017-15506039 AAGAGGGCCTAGAGCCTTCTTGG + Intronic
972578632 4:40375256-40375278 TAGATGGCCTAGCGCCCTGAAGG - Intergenic
973889932 4:55358570-55358592 ACAAGGGCCTAGGGCCTAGCAGG - Intronic
974818760 4:67039515-67039537 GAGAGGTCTTAGGGCCATGAAGG + Intergenic
975645003 4:76537343-76537365 ATGATTGCCTAGGGCCTTGAAGG + Intronic
980663973 4:135904249-135904271 AGGAGGTCATAGGGCCTGGAAGG + Intergenic
983684298 4:170389443-170389465 GAGATTGCCTAGGGCCTTGTGGG + Intergenic
985632608 5:1021899-1021921 CAGAGGGCCTGGGGCCTGGTGGG - Intronic
985965840 5:3338355-3338377 AAGAGGGCCTAGGGCCACGGTGG - Intergenic
986358496 5:6952135-6952157 AACAGGGCCCAGGGCCCTGGTGG - Intergenic
987825867 5:23029690-23029712 AAGAGGGGCAAGGGAGTTGAGGG - Intergenic
988215650 5:28268646-28268668 AAGGGGGCGTAGGGCCATTATGG + Intergenic
990924838 5:61008830-61008852 AATATTGACTAGGGCCTTGAAGG + Intronic
990991159 5:61685363-61685385 ATGAGTGCCAAGGACCTTGAAGG - Intronic
993287389 5:86016576-86016598 AAGAGAACCTATTGCCTTGAAGG - Intergenic
993809586 5:92458874-92458896 AAGAGGGGCTAGGCACTTCAGGG - Intergenic
995921696 5:117322141-117322163 AAGAGGTGATAGGGCCATGAGGG - Intergenic
998749195 5:145298522-145298544 AAGAGGCAATTGGGCCTTGAAGG + Intergenic
1002440134 5:179260022-179260044 AAGTGGGCATAGGGCCCTGCCGG + Intronic
1004488974 6:16095764-16095786 TAAAGGGCCTATGCCCTTGAGGG - Intergenic
1006262527 6:32887165-32887187 AAGAGGTCCAAGGGCACTGAGGG - Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006360981 6:33586876-33586898 ACCAGGGCCCAGGGCCTGGAGGG - Intergenic
1009535392 6:64876492-64876514 AAGAGTGCCTAGGACATTAAAGG - Intronic
1010705962 6:79111128-79111150 CAGAGGAGCAAGGGCCTTGATGG + Intergenic
1011403254 6:86987886-86987908 AAGAGGTGATAGGGCCGTGAAGG - Intronic
1013276019 6:108585561-108585583 AAGAGGGCAGAGGGCCTTCCTGG - Intronic
1017501869 6:155033178-155033200 CAGAGGGCCTGGGGCCGTCATGG - Intronic
1018986654 6:168643064-168643086 TAGAGGGCCTAGGGCTTTGAAGG - Intronic
1019646848 7:2135201-2135223 AGGAGGGCCTAGTGGCCTGAGGG - Intronic
1020135518 7:5585893-5585915 AAGAGGGCCCAAAGCCCTGAAGG - Intergenic
1020313612 7:6888297-6888319 AAGGGGTCCTATGGCCTTTAAGG + Intergenic
1022469733 7:30674854-30674876 AAGGTGGCCTGGGGCCTGGAAGG - Intronic
1023240993 7:38147057-38147079 ACGAGGGCCTAGCTCCTGGATGG + Intergenic
1023646239 7:42318817-42318839 TAGAGGACCTACTGCCTTGAAGG + Intergenic
1023863516 7:44228461-44228483 GAGAGGGCCTAGGGGCATGGGGG + Intronic
1027888624 7:83941275-83941297 AAAATGGCCTATGCCCTTGAAGG + Intergenic
1028445959 7:90924321-90924343 AAGAGGTGCTTGGGTCTTGAGGG - Intronic
1032081702 7:128862161-128862183 TAGAGAGCGTAGGGCCTTCAAGG - Intergenic
1034471186 7:151255193-151255215 AGGAGGGTCTAGGGCCTTGTGGG - Intronic
1034931425 7:155166778-155166800 CTGAGGGCCGAGGGCCTTCACGG + Intergenic
1035572001 8:678892-678914 ATGAGGGCCCAGAGCCGTGAGGG - Intronic
1036704872 8:11039512-11039534 ATGAGGACATTGGGCCTTGACGG + Intronic
1037406441 8:18547449-18547471 AAGAGGGACTACCCCCTTGAGGG - Intronic
1038496539 8:28007281-28007303 AAGAAGGCCTGGTGCCTGGAAGG - Intergenic
1038611844 8:29065919-29065941 AGGAGGGCCTGGGGGGTTGAGGG - Intergenic
1040984706 8:53280875-53280897 TAGATGGCGTAGGGCCTTGGAGG + Intergenic
1042634888 8:70863103-70863125 CAGAGAGACTAGAGCCTTGAGGG + Intergenic
1046619102 8:116509064-116509086 AAGAGGGTCAAGGGAGTTGAGGG + Intergenic
1047624177 8:126639125-126639147 AAGATGCCCTTGGGCTTTGATGG - Intergenic
1047785952 8:128153998-128154020 AAGAAGGCCTACACCCTTGAAGG - Intergenic
1050355724 9:4781119-4781141 AAGAGAACCTACTGCCTTGAAGG + Intergenic
1050601271 9:7254135-7254157 AAGTGGGCCAAAGGCCTTAAGGG - Intergenic
1052270917 9:26627091-26627113 AAGAGGACTTAGGGCAGTGAGGG + Intergenic
1052744411 9:32426057-32426079 GACAGGGCCCAGGGCCTTGGCGG + Intronic
1053593477 9:39534994-39535016 AAAAGGGCCTGGGGCCTGGGGGG - Intergenic
1053662857 9:40296553-40296575 AAAAGGGGAAAGGGCCTTGAAGG - Intronic
1053664229 9:40306260-40306282 AAAAGGGGAAAGGGCCTTGAAGG - Intronic
1053851211 9:42289702-42289724 AAAAGGGCCTGGGGCCTGGGGGG - Intergenic
1053913305 9:42926728-42926750 AAAAGGGGAAAGGGCCTTGAAGG - Intergenic
1054374986 9:64442777-64442799 AAAAGGGGAAAGGGCCTTGAAGG - Intergenic
1054520387 9:66070025-66070047 AAAAGGGGAAAGGGCCTTGAAGG + Intergenic
1054521757 9:66079731-66079753 AAAAGGGGAAAGGGCCTTGAAGG + Intergenic
1054572829 9:66830283-66830305 AAAAGGGCCTGGGGCCTGGGGGG + Intergenic
1060926259 9:127457386-127457408 AGGAGGGCCCAGTACCTTGATGG - Exonic
1061368854 9:130186804-130186826 TAGAGGGCCTGTGGCCGTGAGGG + Intronic
1062716550 9:138013332-138013354 CAGAGGGCCTCTGGCCTTGGCGG + Intronic
1189317298 X:40065136-40065158 AAGAAAGCCTAGGTCCTTGATGG + Intronic
1189386808 X:40543801-40543823 GAAAGGGCCAAGGGCCTTGATGG + Intergenic
1189593874 X:42543724-42543746 AGGAGAGCCTAGTGCCCTGAAGG + Intergenic
1192667370 X:73101953-73101975 AAGAGAACCTATTGCCTTGAAGG - Intergenic
1192822370 X:74658430-74658452 TAGAGAGCCTTGGGCCTTAAGGG - Intergenic
1193163570 X:78257069-78257091 AAGAGAACCTGGTGCCTTGAAGG - Intergenic
1194728869 X:97431186-97431208 AAGAGGTGATAGGGGCTTGATGG - Intronic
1195502053 X:105613229-105613251 AAGAGAACCCAGTGCCTTGAAGG + Intronic
1195848039 X:109249351-109249373 AATAGGACCTAGGGCCCAGAGGG + Intergenic
1195925944 X:110024737-110024759 AAGAGGGCCTTGGGAGATGATGG + Intronic
1195984590 X:110615201-110615223 AAGAGAACCTACTGCCTTGAAGG - Intergenic
1197655878 X:129115407-129115429 ATGAGGCCCTAGGGAATTGAGGG + Intergenic
1198785507 X:140283595-140283617 AAGAGGACCTGCTGCCTTGAAGG - Intergenic
1199138927 X:144287390-144287412 AAGAGAGCCTACCGCGTTGAAGG - Intergenic
1199154160 X:144526229-144526251 AATAGGGCCAAGAGACTTGAGGG - Intergenic
1199850391 X:151721741-151721763 AAGAGGGCCTAGGGCCTTGAGGG - Intronic
1200138787 X:153887101-153887123 AGGAAGGCCTAGGGCCCCGATGG + Intronic