ID: 1199850715

View in Genome Browser
Species Human (GRCh38)
Location X:151723368-151723390
Sequence AACTTTGCAAAGCTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 254}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199850715_1199850725 14 Left 1199850715 X:151723368-151723390 CCCAGCCCCAGCTTTGCAAAGTT 0: 1
1: 0
2: 4
3: 27
4: 254
Right 1199850725 X:151723405-151723427 CATGCAAACCAGTGCTTGTGGGG No data
1199850715_1199850726 15 Left 1199850715 X:151723368-151723390 CCCAGCCCCAGCTTTGCAAAGTT 0: 1
1: 0
2: 4
3: 27
4: 254
Right 1199850726 X:151723406-151723428 ATGCAAACCAGTGCTTGTGGGGG No data
1199850715_1199850723 12 Left 1199850715 X:151723368-151723390 CCCAGCCCCAGCTTTGCAAAGTT 0: 1
1: 0
2: 4
3: 27
4: 254
Right 1199850723 X:151723403-151723425 CTCATGCAAACCAGTGCTTGTGG No data
1199850715_1199850730 27 Left 1199850715 X:151723368-151723390 CCCAGCCCCAGCTTTGCAAAGTT 0: 1
1: 0
2: 4
3: 27
4: 254
Right 1199850730 X:151723418-151723440 GCTTGTGGGGGTGTGGTTCTGGG No data
1199850715_1199850724 13 Left 1199850715 X:151723368-151723390 CCCAGCCCCAGCTTTGCAAAGTT 0: 1
1: 0
2: 4
3: 27
4: 254
Right 1199850724 X:151723404-151723426 TCATGCAAACCAGTGCTTGTGGG No data
1199850715_1199850727 20 Left 1199850715 X:151723368-151723390 CCCAGCCCCAGCTTTGCAAAGTT 0: 1
1: 0
2: 4
3: 27
4: 254
Right 1199850727 X:151723411-151723433 AACCAGTGCTTGTGGGGGTGTGG No data
1199850715_1199850729 26 Left 1199850715 X:151723368-151723390 CCCAGCCCCAGCTTTGCAAAGTT 0: 1
1: 0
2: 4
3: 27
4: 254
Right 1199850729 X:151723417-151723439 TGCTTGTGGGGGTGTGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199850715 Original CRISPR AACTTTGCAAAGCTGGGGCT GGG (reversed) Intergenic
900504563 1:3022856-3022878 ATCCTCCCAAAGCTGGGGCTAGG - Exonic
901050475 1:6423746-6423768 GACTGTGCCAGGCTGGGGCTGGG + Intronic
901851325 1:12017838-12017860 AACTTAGAAAAACTGGGGCCGGG - Intergenic
902659606 1:17891978-17892000 ACCTTTGGAAGGCAGGGGCTGGG - Intergenic
905450447 1:38052684-38052706 AACTCTGAAAGGCTGGGGCTAGG + Intergenic
905973894 1:42161955-42161977 TACTTGGAAAAGCTGTGGCTGGG + Intergenic
906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG + Intergenic
906725348 1:48040304-48040326 ATGTTTGCACAGCTGGGGATGGG + Intergenic
906786469 1:48620184-48620206 GACTTTGCAAAGATGGGGATGGG + Intronic
907048622 1:51315116-51315138 AAGTTTCCACAGGTGGGGCTGGG - Intronic
912757763 1:112338674-112338696 CACTTTGGGAAGCTGAGGCTTGG + Intergenic
913672242 1:121107872-121107894 AACATTGCAAAGGTGGGTGTGGG + Intergenic
914024006 1:143895233-143895255 AACATTGCAAAGGTGGGTGTGGG + Intergenic
914662495 1:149803264-149803286 AACATTGCAAAGGTGGGTGTGGG + Intronic
914991571 1:152503412-152503434 AACTTTGTAAACGTGAGGCTTGG - Intergenic
915528508 1:156490350-156490372 AACTTTGAAGGGTTGGGGCTGGG - Intronic
917815731 1:178708143-178708165 AAGTTTCCACAGCTGGGGCTGGG + Intergenic
919419128 1:197349702-197349724 AAGTTTGGAATGCTGTGGCTTGG + Intronic
920031264 1:203038769-203038791 AACTTCTCAGGGCTGGGGCTGGG - Intronic
920397973 1:205660289-205660311 ACATTAGCACAGCTGGGGCTGGG - Intronic
922873230 1:228920053-228920075 TATTTTGCAATGCTGGGGTTTGG + Intergenic
924655532 1:245971935-245971957 GACTCTGCAAAGCTGGGCTTTGG - Intronic
1063596636 10:7441478-7441500 ATCACTGCACAGCTGGGGCTGGG - Intergenic
1063885496 10:10573867-10573889 AACTCTGGAAAGTAGGGGCTTGG - Intergenic
1067254895 10:44627764-44627786 ATCTTTGCAAGGCTGGGGCAGGG - Intergenic
1067791608 10:49292588-49292610 AACTAGGCATAGGTGGGGCTTGG - Intergenic
1069900257 10:71702770-71702792 AACTTTGCAGGGCTGGGGCAGGG + Intronic
1071393274 10:85196513-85196535 CACTTTGGGAGGCTGGGGCTGGG - Intergenic
1073983126 10:109177532-109177554 AACTCTTGAAAGCTGTGGCTGGG - Intergenic
1074528824 10:114282832-114282854 ATGTCTGCAAAGCTGGTGCTCGG - Intronic
1076138386 10:128060551-128060573 CACTTGGCAACACTGGGGCTGGG + Intronic
1076247652 10:128959801-128959823 ACCTTTGCAGCTCTGGGGCTGGG + Intergenic
1076858363 10:133128205-133128227 GGCTTTGCACAGCTGCGGCTTGG - Intronic
1077325685 11:1963030-1963052 AGCTTTGCAGAGCTGGGCCCAGG - Intronic
1081050464 11:38333578-38333600 AATTCTGCATAGCTGGTGCTGGG - Intergenic
1082879385 11:58023236-58023258 AACTAAGCAAACCTAGGGCTTGG + Intergenic
1083014256 11:59436517-59436539 AAATGTTCAAAGCTGGGGTTGGG - Intergenic
1083280995 11:61627295-61627317 AACTTTGCAAAGCTCTGTCCTGG + Intergenic
1085182944 11:74551410-74551432 AACTCTGAGAAGCTGGGGCTAGG + Intronic
1088576318 11:111275296-111275318 AAATCTCCAAAGCTGGGGGTAGG + Intronic
1089180916 11:116582284-116582306 AGCTCTGCAAAGCAGGGGGTTGG + Intergenic
1090702644 11:129310352-129310374 AACTTTGCAGAGCTGGGATTGGG + Intergenic
1090798647 11:130156784-130156806 AGCTTTGCAGTGCTGGGGCCGGG + Intergenic
1090813345 11:130267642-130267664 CACTTTGCAATGCTGAGGCCAGG - Intronic
1202808665 11_KI270721v1_random:18209-18231 AGCTTTGCAGAGCTGGGCCCAGG - Intergenic
1092961527 12:13601030-13601052 CACTTTGAAAGGATGGGGCTGGG + Intronic
1095267617 12:40178911-40178933 AACTTTGGAAGGCTGAGGCAGGG - Intergenic
1096354080 12:50925333-50925355 AACTTCTCAAAGTTGGGGTTGGG - Exonic
1096477994 12:51920358-51920380 ATCTTGGCAAAGGTGGGGATGGG + Intronic
1096528553 12:52229272-52229294 AACTTCTCAAAGTTGGGGTTGGG + Intergenic
1096763808 12:53866482-53866504 AAATTTGGGAAGCTAGGGCTGGG - Intergenic
1097100061 12:56581405-56581427 AAATTTGCAAAGCAAGGGATCGG - Exonic
1099848364 12:88058604-88058626 AACAGTGTAGAGCTGGGGCTGGG - Intronic
1100201501 12:92303612-92303634 AACTGTTCAAACCTGGGGCAAGG - Intergenic
1100367408 12:93934440-93934462 AACTTTTAAAAGCCAGGGCTTGG + Intergenic
1100420102 12:94424318-94424340 AAATTTGCAAAGCAAGGGATCGG + Intronic
1101080549 12:101178726-101178748 AATCTTCAAAAGCTGGGGCTAGG + Intronic
1101134153 12:101722605-101722627 CACTTTGAGAAGCTGAGGCTGGG + Intronic
1103613477 12:122137972-122137994 AATGGTGCACAGCTGGGGCTGGG - Intronic
1104430072 12:128709048-128709070 TAGTTTGCAAAGCTGGGGCTCGG - Intergenic
1104621819 12:130319500-130319522 AACTTTGCGGAGTTGGGGCTGGG + Intergenic
1105816457 13:24040618-24040640 AACTTTACAAAATTGGTGCTTGG - Intronic
1106340379 13:28820894-28820916 AATTATCCAAAGCTGGGGGTGGG - Intronic
1106447338 13:29848692-29848714 AACCTTACAGTGCTGGGGCTGGG - Intronic
1107952810 13:45479692-45479714 GACTGGGCAGAGCTGGGGCTTGG + Intronic
1110033777 13:70653588-70653610 AACATAGCAAATGTGGGGCTGGG - Intergenic
1114741591 14:25103857-25103879 AACTGGACAAACCTGGGGCTTGG - Intergenic
1116315787 14:43390305-43390327 AAATATGCAAAGCTAAGGCTGGG + Intergenic
1116436852 14:44904756-44904778 AACTTATAAAAGATGGGGCTAGG - Intronic
1117303386 14:54449961-54449983 AAGTTTGCTAAGGTGGGTCTAGG - Intergenic
1118285960 14:64472995-64473017 AATTTTGCAAAGCTGGGGGTTGG + Exonic
1118448985 14:65880169-65880191 CACTTTGCAAAGCTTGTGCAGGG + Intergenic
1121432781 14:93899387-93899409 TACTTTGCAGGGCTTGGGCTTGG - Intergenic
1122924834 14:104894776-104894798 AGCTCTGCACAGCCGGGGCTGGG + Exonic
1124965767 15:34432484-34432506 AACTTTGCAACGAGGAGGCTGGG - Intronic
1128114131 15:65094790-65094812 AACTATGCCAAGCTGGGGGCTGG + Intronic
1128145429 15:65330067-65330089 TACTTTACAAAGCTGTGGCAAGG - Intronic
1129426964 15:75470449-75470471 AATTTTAGAAATCTGGGGCTGGG - Intronic
1130194905 15:81770632-81770654 AACATTTCAAAACTGGGGCTAGG + Intergenic
1130411639 15:83653555-83653577 GACTTTGCAGAGCTGGCGCCCGG + Intergenic
1131322694 15:91410388-91410410 AACTGCTCAAAGCTGGAGCTTGG - Intergenic
1132833389 16:1940748-1940770 TGCTTTGCACAGCTGGGGCCAGG - Intronic
1133422765 16:5661005-5661027 AGCTTTGCTGTGCTGGGGCTGGG + Intergenic
1133621263 16:7528874-7528896 AACCTTGCAATGCTAGAGCTGGG + Intronic
1134827497 16:17296323-17296345 AAGATTGCAGAGATGGGGCTGGG + Intronic
1135429548 16:22371628-22371650 AACTTAGCAAAACTGGGGAAAGG + Intronic
1140031549 16:71343314-71343336 CACGATGCAAAGCTGGGGCTTGG + Intergenic
1140227025 16:73086655-73086677 AACTTTGGGAAGCTGAGGCAGGG + Intergenic
1140932559 16:79641141-79641163 AACTGTGCACAGCTGCCGCTCGG + Intergenic
1143425975 17:6838244-6838266 AACATCACACAGCTGGGGCTGGG - Intergenic
1144760784 17:17706195-17706217 AGATTTGCAGAGCTGGGGCGAGG + Intronic
1147666204 17:42150128-42150150 CACTTTGGAAGGCTGAGGCTGGG - Intronic
1148339165 17:46863165-46863187 AACCTTCCCAAGCTGGGGCTGGG - Intronic
1149877713 17:60254403-60254425 TACTTTGAAAAACTTGGGCTGGG + Intronic
1150350279 17:64438897-64438919 AAGTTTGGAAAGTTGGGGCCAGG - Intergenic
1151151394 17:72090759-72090781 TTCCTTGCAGAGCTGGGGCTGGG - Intergenic
1151319214 17:73342644-73342666 TCCTCTGCAAAGCTGGGGCCTGG - Intronic
1151455783 17:74225135-74225157 AACTTGGCAAAGGTGGGGGCAGG + Intronic
1152485355 17:80587653-80587675 AACTTTTCAAAGTCGGGGCCAGG - Intronic
1152721028 17:81923893-81923915 AACTTTGAAAAGCTGGGGGTGGG + Intronic
1154239932 18:12643941-12643963 CACTTTGGAAGGCTGGGGGTGGG + Intronic
1155622450 18:27795092-27795114 AAATTTTTAAAGCTGGGGTTGGG + Intergenic
1156049332 18:32913274-32913296 CACTTTGCAAGGCTGAGGCAGGG + Intergenic
1157243827 18:46036409-46036431 AACCTAGGAAAGCTGGGCCTTGG + Intronic
1157820491 18:50764480-50764502 AACCAGGAAAAGCTGGGGCTGGG - Intergenic
1157918707 18:51694646-51694668 AAATGAGCAAATCTGGGGCTGGG + Intergenic
1158997720 18:62940215-62940237 CACATTGCAAAGCTGGGGAATGG - Intronic
1161568205 19:5015199-5015221 GACTTGGCACACCTGGGGCTCGG - Intronic
1161842732 19:6692799-6692821 CCCTTTGCAAAGATTGGGCTGGG - Intronic
1163750667 19:19075541-19075563 AACGTGGCAAGGCTGGGCCTCGG + Intronic
1165482961 19:36076310-36076332 CACTTTGGAAGGCTGGGGCAGGG + Intronic
1165527977 19:36372175-36372197 AACTTTCCAAACCTGGGGAAAGG + Intronic
1167236754 19:48320237-48320259 AACTTGGGAAAGCTGGGGGCTGG + Intronic
925591786 2:5517124-5517146 ATCTTTGCACAGCTGGACCTTGG - Intergenic
925609560 2:5692215-5692237 TGCTTTGCAAAGATGGGGGTGGG - Intergenic
925802123 2:7611752-7611774 AAGATTGGAAAGCTGGGGCTGGG - Intergenic
926617022 2:15006726-15006748 GAGTTTGCAAAGCAGGTGCTTGG - Intergenic
927961130 2:27241268-27241290 GGATTTGGAAAGCTGGGGCTAGG + Intronic
928313937 2:30231917-30231939 AAGGTTGCAAAGGTGGGGGTGGG + Intronic
931117240 2:59178292-59178314 AACTTTGGGAGGCTGGGGCGGGG + Intergenic
931903564 2:66819172-66819194 GTCTTTACAAAGCTGGGTCTTGG + Intergenic
932301751 2:70672373-70672395 AACTCAGAAAAGCTGGGGATGGG + Intronic
933465093 2:82641574-82641596 CACCTTGCTCAGCTGGGGCTGGG - Intergenic
933507213 2:83192690-83192712 TACTTTGGAAGGCTGAGGCTAGG - Intergenic
933723513 2:85413091-85413113 AGCTTTCCAGCGCTGGGGCTGGG - Intronic
936181948 2:110274761-110274783 AACTAAGCAGAGCTGGGGCTAGG + Intergenic
936230620 2:110696912-110696934 AACTAAGCAGAGCTGGGGCTAGG - Intergenic
936932041 2:117799758-117799780 TACCTTGCAAAGCAGAGGCTGGG - Intergenic
937966005 2:127511246-127511268 AAAATAGCAGAGCTGGGGCTTGG - Intronic
938092875 2:128444675-128444697 AACTTCCCACAGCGGGGGCTTGG - Intergenic
938965393 2:136383788-136383810 GACTTTGCAAAGCTTTGGCGGGG + Intergenic
939248732 2:139659795-139659817 CACTTTGGTAGGCTGGGGCTGGG + Intergenic
944620246 2:201506796-201506818 AACTTTGGGAAGCTGGGACAGGG - Intronic
946527685 2:220538718-220538740 TACTTTGCAGGGCTGGGGCAAGG - Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
946910351 2:224454628-224454650 CACTTTGCAAAGCTCTGGCTGGG + Intergenic
947323538 2:228949299-228949321 AACTGTGCATTGCTGGGGGTTGG + Intronic
947872561 2:233447591-233447613 AAGTTTGCGACCCTGGGGCTGGG + Intronic
947921520 2:233879351-233879373 AACTTTTTAAAACTGGGGTTTGG + Intergenic
1168925334 20:1574515-1574537 AAGTTTGCAAAGCTGGACCCAGG - Intronic
1168929212 20:1607543-1607565 AAGTTTGCAAAGCTGGACCCAGG - Intronic
1169585818 20:7084076-7084098 AACTTTGCAAAGCTGTAAATTGG - Intergenic
1170109238 20:12787133-12787155 AACTTCTCTAAGCTGGGGCCAGG + Intergenic
1170441762 20:16386430-16386452 ACCTTTGCTGGGCTGGGGCTGGG + Intronic
1170673381 20:18455719-18455741 AAATATGCAAAGCCTGGGCTGGG + Intronic
1170827223 20:19807144-19807166 AACCTTGTAAAGCTTGTGCTTGG + Intergenic
1171969473 20:31554790-31554812 AACTTTGCCATGCTGGGACTTGG + Exonic
1175005012 20:55672563-55672585 CACTTAGCCAAACTGGGGCTGGG + Intergenic
1176384259 21:6129596-6129618 AAATTAGCAAAGGTGGGGCACGG - Intergenic
1178499819 21:33116438-33116460 AACTTCGCCCAGCTGTGGCTGGG - Intergenic
1179739213 21:43408648-43408670 AAATTAGCAAAGGTGGGGCACGG + Intergenic
1181452964 22:23036126-23036148 CACTTTGAGAAGCTGGGGGTGGG + Intergenic
1182105344 22:27685242-27685264 AAATTCACACAGCTGGGGCTGGG - Intergenic
1182291861 22:29286260-29286282 CACTTTGGAAGGCTGAGGCTGGG - Intronic
1184404155 22:44290656-44290678 AATTTTGCCAAGCTGGGATTCGG - Intronic
1184629325 22:45763477-45763499 CACTCTGCAGACCTGGGGCTGGG - Intronic
1184830181 22:46980721-46980743 ATATTTGTAAAGCTGTGGCTGGG + Intronic
949463139 3:4315749-4315771 AAATTTTAAAAGATGGGGCTGGG + Intronic
949916332 3:8967481-8967503 CACTTTGGAAGGCTGAGGCTGGG - Intergenic
950638880 3:14335235-14335257 AACTTTCTGAAGATGGGGCTGGG - Intergenic
950951468 3:17004337-17004359 GACTCTGCAAAGCTAGGGCAGGG + Intronic
954085844 3:48243201-48243223 CACTTTGGAAGGCTGAGGCTAGG + Intronic
954818883 3:53307330-53307352 AAAATTACAAATCTGGGGCTTGG - Intronic
955689929 3:61581024-61581046 GACTTTTCAAAGCCTGGGCTTGG + Intronic
956016677 3:64891228-64891250 GACTTTGAAAAGCTGGGTCAAGG + Intergenic
956435733 3:69232877-69232899 AAATTTGCAACTTTGGGGCTTGG - Intronic
956685446 3:71823076-71823098 AGCTTTCCAAAGCTGCAGCTTGG - Intergenic
956933264 3:74070580-74070602 CACTGTGCAGACCTGGGGCTTGG - Intergenic
960584160 3:119305322-119305344 TACTTTGAAAAACTGGGGATGGG - Intronic
961453101 3:127011364-127011386 ATCTCTGCAGAGCTGGGCCTGGG + Intronic
961646853 3:128397304-128397326 AGCTTTGTGAAGCTGGGGCCTGG + Intronic
961932996 3:130553966-130553988 AGCAGTGCTAAGCTGGGGCTTGG - Intergenic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
963003442 3:140704548-140704570 TAGTCTGCAATGCTGGGGCTTGG - Intergenic
965522896 3:169686138-169686160 ATATTTGCAAATCTGAGGCTGGG + Intergenic
965733075 3:171792765-171792787 AAGTTTGCAAATCTGGGGGGAGG - Intronic
966418809 3:179717173-179717195 GACTTTGCTAAGCTGAGGTTGGG + Intronic
966920395 3:184607426-184607448 AGCTTAGCAAAGGTGGGACTGGG + Intronic
967052824 3:185800491-185800513 CACTTTGCAAGGCTGAGGCAAGG + Intronic
968172783 3:196523860-196523882 GGTTTTGCAAAGCTGGGCCTTGG - Intergenic
969468083 4:7369648-7369670 CACTCAGCAAAGCTGGGGCCAGG - Intronic
970246135 4:14065876-14065898 AGCTGTGCAAAGCTCGGGGTGGG + Intergenic
971118917 4:23681797-23681819 AATTTTTCCAAGGTGGGGCTGGG + Intergenic
971780413 4:31027096-31027118 TAGTCAGCAAAGCTGGGGCTGGG - Intronic
972635753 4:40882695-40882717 AGCTTTGTGATGCTGGGGCTGGG - Intronic
974169931 4:58252808-58252830 AATGATGCAAAGCTGGGTCTGGG + Intergenic
974685194 4:65217963-65217985 AACTTTCCAAATCTGGGGAAGGG + Intergenic
975213541 4:71728706-71728728 AACTGGGCAGAGATGGGGCTGGG - Intergenic
975738198 4:77402512-77402534 AACTTTGCAGAGATGGGGATAGG + Intronic
976301120 4:83516489-83516511 TACTTTGAAAGGCTGGGGCAAGG - Intronic
976351258 4:84062282-84062304 AAATTTGTAGTGCTGGGGCTGGG - Intergenic
978339362 4:107706181-107706203 AACTTTCCAAATCTGGGGAAAGG - Intronic
978386893 4:108185534-108185556 AAGTCTGTAAATCTGGGGCTAGG - Intergenic
979386113 4:120067268-120067290 AACCCTGTAAAGCTGTGGCTTGG - Intergenic
981606719 4:146547475-146547497 ATCTTTGCAACCCTGGGGCCAGG - Intergenic
981733797 4:147927626-147927648 AACTAGGCAAAGCTGGGGTTTGG + Intronic
982115847 4:152097839-152097861 CACTTTGTGATGCTGGGGCTGGG - Intergenic
983859206 4:172683997-172684019 TAATTCGCAAAGCTGGAGCTGGG - Intronic
985139653 4:186826701-186826723 ATATTGGCAAAGCAGGGGCTAGG + Intergenic
985320234 4:188702594-188702616 AACAATGCAAAGCTGGGGGTGGG + Intergenic
985514979 5:337749-337771 CCCTTCCCAAAGCTGGGGCTCGG + Intronic
987235654 5:15938897-15938919 AACGTAACAAAGGTGGGGCTTGG - Exonic
990441219 5:55847297-55847319 AAAGTTGCAAAGATAGGGCTGGG + Intergenic
991366601 5:65874984-65875006 AATTTTAAAAGGCTGGGGCTAGG + Intergenic
992623435 5:78615932-78615954 ACCTTTGCAAAGCTGGTGCTAGG + Intronic
992632482 5:78695474-78695496 GACTTTGGAAGGCTGAGGCTTGG - Intronic
995767104 5:115630440-115630462 CACTTTGCAAAGGTGGGTATGGG + Intronic
996863221 5:128088302-128088324 AACTCTTCAAAGCTGATGCTAGG + Intronic
997627923 5:135343608-135343630 AACTTTCCAAGGGTGTGGCTTGG - Exonic
998792351 5:145778597-145778619 TTCTCTGCAAAGCTGTGGCTGGG - Intronic
1000332562 5:160217454-160217476 AACACTGCAAAGCTGGGAATTGG + Intronic
1000465474 5:161570223-161570245 AGCTCTGCAAAAATGGGGCTGGG + Intronic
1001710299 5:173773018-173773040 ATCTTTGAAAAGTTGAGGCTGGG + Intergenic
1003110104 6:3246189-3246211 AAATTTAAAAAGTTGGGGCTGGG - Intronic
1003238750 6:4322954-4322976 AAGGTTGGAAAGCTGGGGGTGGG - Intergenic
1003911731 6:10749424-10749446 AACTAAGCAAAGCTAGAGCTGGG - Intronic
1003985711 6:11432427-11432449 AACTTTGGAAAGCTGAGCTTGGG + Intergenic
1005590336 6:27318262-27318284 TGCTTTGTGAAGCTGGGGCTGGG - Intergenic
1006801540 6:36763045-36763067 ATGTGTGCAAGGCTGGGGCTGGG - Intronic
1006977136 6:38113584-38113606 AACTTTGCAGGGCAGGGGTTGGG + Intronic
1006977496 6:38116785-38116807 AAATTTCCAAAGCTGGGCCAAGG - Intronic
1007765621 6:44158201-44158223 AACCTTGCCAGACTGGGGCTAGG + Intergenic
1008428684 6:51389134-51389156 ACCTTTGCACAGTTGGGGCATGG + Intergenic
1009963324 6:70551362-70551384 AACTTTGCAAGGCCGAGGCTGGG + Intronic
1010649092 6:78429881-78429903 TACTATGCATATCTGGGGCTGGG - Intergenic
1011072614 6:83402201-83402223 TACCTTGCAAAGCTGAGGCAAGG + Intronic
1011561413 6:88620857-88620879 GTCTTTGTAAAGCTGGGTCTGGG + Intronic
1012418328 6:99034341-99034363 CAGTTTGCAAAGATGTGGCTCGG - Intergenic
1014130823 6:117830016-117830038 AAGTTTGCTACGCTGGAGCTGGG + Intergenic
1014575536 6:123065965-123065987 AACTTTCCAAATGTGGGTCTGGG - Exonic
1015319629 6:131857945-131857967 AATTATTCAAAGCTAGGGCTTGG - Intronic
1015731941 6:136357911-136357933 AAATTTGCAAAGCTGGTGACAGG + Intronic
1016381501 6:143487326-143487348 AACTTACAAAAGCTGGTGCTTGG - Intronic
1016737972 6:147500988-147501010 CACTTTGAGAAGCTGGGGCCAGG + Intergenic
1016951648 6:149586502-149586524 ATCTTTCCAAAGCTGGGTTTTGG - Intronic
1021505909 7:21384961-21384983 AACTCTGCAAAGTTGGGGATGGG - Intergenic
1021505919 7:21384970-21384992 AACTTTGCAGAGTTGGGGGAGGG + Intergenic
1021627519 7:22608934-22608956 AACTTAGCAAGGCAGTGGCTAGG + Intronic
1027184190 7:75960554-75960576 AACTTTGCAAGGCTGAGGCAGGG - Intronic
1027993807 7:85397701-85397723 AACTTTCCAAAGTTGGGGGTGGG - Intergenic
1028251461 7:88543701-88543723 GGTTTTGCAAAGCTGGGCCTTGG + Intergenic
1028613614 7:92739311-92739333 AAGTTTGCACATCTGGAGCTTGG - Intronic
1028614630 7:92752176-92752198 AACTTCTCAAAGCTGAGCCTAGG - Intronic
1030823444 7:114124302-114124324 AACTTTTCAAATCTGGAGATTGG - Intronic
1031637766 7:124122062-124122084 AACAGTGGAAAGCAGGGGCTGGG + Intergenic
1031987024 7:128169806-128169828 AACTTTGGTAAGCTGGAGATGGG + Intergenic
1033033796 7:137851578-137851600 ATGTTTGCAAAGCTGGGTTTTGG - Intergenic
1034559468 7:151870840-151870862 ACGTTTGCAGAGATGGGGCTGGG - Intronic
1034746614 7:153529093-153529115 ATCTTTGCAAAGCTGGGTTTTGG - Intergenic
1035145450 7:156811104-156811126 AACTATTCAAAAGTGGGGCTGGG - Intronic
1035242277 7:157540002-157540024 AACTTTGCAAAGGTGAGGTCAGG + Exonic
1036205496 8:6802799-6802821 AAATTGGCAAGGCTGGGGTTGGG - Intergenic
1037748521 8:21664846-21664868 AACAGTGGAAAGCTGGGGGTGGG + Intergenic
1039328051 8:36506342-36506364 GACTCTACAAAGCTGGAGCTGGG + Intergenic
1040363357 8:46688885-46688907 AACTTTGGAAGGCTGAGGCTAGG - Intergenic
1040434047 8:47372313-47372335 ATCTTTGCATAGCCGGTGCTAGG + Intronic
1040697456 8:50019035-50019057 AAGTTGACAAAGCTGGGTCTGGG + Intronic
1040837867 8:51751679-51751701 AACTATAAGAAGCTGGGGCTGGG + Intronic
1042122240 8:65500642-65500664 AACTTACCAAATCTGAGGCTGGG + Intergenic
1043008680 8:74854634-74854656 TACTGTGCTAAGCTGGTGCTTGG + Exonic
1044399854 8:91758077-91758099 TACTGTGCAGAGCTGAGGCTTGG - Intergenic
1044790030 8:95837704-95837726 AACTTGCCAAATATGGGGCTGGG - Intergenic
1044821548 8:96159079-96159101 AACCTTGCAGCGCTGGGGTTCGG - Intronic
1046789118 8:118301968-118301990 AAATTTAGAAAGCTCGGGCTAGG + Intronic
1047904774 8:129460932-129460954 AACTTTGCAAGGTTCAGGCTAGG - Intergenic
1049817820 8:144616119-144616141 ACATTTGCAAAGCTGCTGCTTGG + Intergenic
1055103668 9:72490872-72490894 TACTTTGGTAAGCAGGGGCTGGG + Intergenic
1055907611 9:81312128-81312150 ATCTTTGTGATGCTGGGGCTGGG - Intergenic
1056525908 9:87442879-87442901 TACTTTGCAGGGCTGGGGCAAGG - Intergenic
1058035545 9:100248708-100248730 TTCTTTGCAATGCTGGGCCTGGG + Intronic
1060739631 9:126089856-126089878 CACTTTGGGAAGCAGGGGCTGGG + Intergenic
1060872591 9:127054730-127054752 TACTTTGGGAAGCTGGGGGTGGG + Intronic
1061705835 9:132452389-132452411 CTCTTTGCAAAGCAGGGGCACGG - Intronic
1061930547 9:133830687-133830709 GAATTTTCAAAGCTGGAGCTGGG - Intronic
1062531866 9:137005238-137005260 CACTTTGGAAGGCTGAGGCTGGG + Intergenic
1062546836 9:137067524-137067546 CACTTTGGGAAGCTGGGGCGGGG + Intronic
1186529933 X:10285232-10285254 AGCTGTGCAAAACTGGGGCTTGG + Intergenic
1187232529 X:17436171-17436193 AACTTCAAAAAGTTGGGGCTGGG + Intronic
1187739811 X:22343391-22343413 AACTGTGGTAAGATGGGGCTGGG + Intergenic
1187862905 X:23698842-23698864 AACTTAGCAGTGCTGGTGCTGGG + Intergenic
1187969827 X:24647974-24647996 AACTTTGAATAGCTGGGGAAGGG - Intronic
1190059848 X:47203577-47203599 AACTTTGCCATGATTGGGCTGGG + Exonic
1190920830 X:54850934-54850956 TTCTTTGCATAGCTGGGGCATGG + Intergenic
1192117722 X:68427493-68427515 GGCTTTACAAAGATGGGGCTGGG - Intronic
1199850715 X:151723368-151723390 AACTTTGCAAAGCTGGGGCTGGG - Intergenic
1200461286 Y:3457814-3457836 GACTTTGCAGGGCTGGGGCAAGG - Intergenic