ID: 1199851019

View in Genome Browser
Species Human (GRCh38)
Location X:151725029-151725051
Sequence TGAGTTGCAAACAAACAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199851018_1199851019 -5 Left 1199851018 X:151725011-151725033 CCTTGGGAGCAATTTAGTTGAGT No data
Right 1199851019 X:151725029-151725051 TGAGTTGCAAACAAACAGCACGG No data
1199851017_1199851019 -4 Left 1199851017 X:151725010-151725032 CCCTTGGGAGCAATTTAGTTGAG No data
Right 1199851019 X:151725029-151725051 TGAGTTGCAAACAAACAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199851019 Original CRISPR TGAGTTGCAAACAAACAGCA CGG Intergenic
No off target data available for this crispr