ID: 1199851827

View in Genome Browser
Species Human (GRCh38)
Location X:151729309-151729331
Sequence TTATAGACAAAGATGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199851827_1199851832 -3 Left 1199851827 X:151729309-151729331 CCCAGCCCCATCTTTGTCTATAA No data
Right 1199851832 X:151729329-151729351 TAAAGAGACGAAGCCTCCCTTGG No data
1199851827_1199851836 16 Left 1199851827 X:151729309-151729331 CCCAGCCCCATCTTTGTCTATAA No data
Right 1199851836 X:151729348-151729370 TTGGCAAAGCAGCCCAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199851827 Original CRISPR TTATAGACAAAGATGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr